Bocavirus Hussein Sabit

Views:
 
Category: Education
     
 

Presentation Description

No description available.

Comments

Presentation Transcript

Slide 1:

By Hussein Sabit, PhD., Faculty of Biotechnology, Misr University for Science & Technology The Use of Real Time PCR Approach for Detecting Human Boca Virus (HBoV)

Introduction:

Introduction Parvoviruses are the smallest known virus, Latin for small – parvus Parvoviridae is family name – 2 subfamilies Parvovirinae vertebrate viruses – 2 types autonomous parvovirus – do not need helper virus. Dependovirus – usually defective particles – need a helper virus to cause infection. Densovirinae invertebrate viruses Hussein Sabit, Ph.D

Background:

Background H uman bocavirus is a newly discovered parvovirus. It has been detected primarily in children with acute lower respiratory tract infection, but its occurrence, clinical profile, and role as a causative agent of respiratory tract disease are not clear. The relative importance of HBoV in viral respiratory tract illnesses is not yet well known. Hussein Sabit, Ph.D

History :

History Human bocavirus (HBoV) is a newly described human virus closely related to bo vine parvovirus and ca nine minute virus. It is currently classified in the genus Bocavirus within the family Parvoviridae. This virus was first identified in respiratory tract specimens from Swedish infants with lower respiratory tract infections (RTIs) However, the pathogenic role of HBoV is uncertain because other viruses have been frequently detected in HBoV-positive children with lower RTIs. Hussein Sabit, Ph.D

Slide 5:

Genetics There are two genotypes of this virus known; type 1 and 2. They appear to have diverged recently. Recombination may occur between strains. The estimated mean evolutionary rate is 8.6 x 10 -4 substitutions/site/year. Hussein Sabit, Ph.D

Slide 6:

Clinical HBoV is found rarely in respiratory samples from healthy subjects. In patients with respiratory complaints, it can be found alone or, more often, in combination with other viruses. The age group most frequently affected is children between the ages of six months to two years . HBoV can be detected not only in respiratory samples but also in blood, urine and stools . Some patients with HBoV seem to have diarrhoea independent of respiratory symptoms. Hussein Sabit, Ph.D

Virus Classification:

Virus Classification Group: Group II ( ss DNA) Family: Parvoviridae Genus: Bocavirus Species: Human bocavirus Hussein Sabit, Ph.D

Phylogenetic analysis of parvovirus genomes:

Phylogenetic analysis of parvovirus genomes Hussein Sabit, Ph.D

Examples of Parvoviruses:

Examples of Parvoviruses Subfamily Genus Species Parvovirinae Dependovirus Adeno -associated virus 2 Parvovirus Minute virus of mice Feline panleukopenia virus Erythrovirus B 19 virus Bocavirus Human bocavirus Densovirinae Iteravirus Bombyx mori densovirus Hussein Sabit, Ph.D

Detection and Treatment:

Detection and Treatment Laboratory Detection HBoV PCR and serology mostly used by research labs. Now included in commercial multiplex assays. Treatment No specific therapy available . Hussein Sabit, Ph.D

Impact of Molecular Methods on Respiratory Viral Diagnostics :

Impact of Molecular Methods on Respiratory Viral Diagnostics Much greater sensitivity vs culture Better understanding of epidemiology of respiratory viruses. Faster turnaround time – greater opportunity to guide therapy. Discovery of new viruses in respiratory tract such as Human bocavirus Viral coinfections recognised as a relatively common entity. Hussein Sabit, Ph.D

Parvovirus Replication:

Parvovirus Replication Can only encode a few proteins, the rest comes from host or other viruses. Need proteins like DNA polymerase and other replication proteins. During S-phase, parvo must be inside cell to be replicated. Hussein Sabit, Ph.D

Attachment and Entry:

Attachment and Entry Attach on surface of potential host Enter by endocytosis and released from endosome , associates with microtubule in cytoplasm and move to nuclear pore Nucleocapsid small enough to pass into the nucleus Hussein Sabit, Ph.D

Transcription/ Translataion:

Transcription/ Translataion Cellular RNA pol II transcribes genes and cellular transcription factor play key roles 1° transcript – various splicing events to make 2 classes based on size larger mRNAs – non-structural, phoshorylated and play role in control of gene expression and in DNA replication smaller mRNAs – structural Hussein Sabit, Ph.D

DNA Replication:

DNA Replication ssDNA to dsDNA – converted by cellular DNA polymerase. rolling-hairpin replication Leading strand mechanism – unique for DNA viruses; no leading/lagging strand. Hussein Sabit, Ph.D

Procapsid:

Procapsid Made from structural proteins and filled with either (+) or (-) DNA as appropriate. A non-structural protein acts as a helicase to unwind dsDNA to get ssDNA. Hussein Sabit, Ph.D

Slide 17:

1- Attachment 2- Entry 3- Transcription 4- Translation 5- Genome replication 6- Assembly 7- Exit Overall Viral Cycle Hussein Sabit, Ph.D

Aim of the work:

Aim of the work The aim of our study was to establish a real-time PCR assay for the rapid detection and quantification of hBoV DNA. Hussein Sabit, Ph.D

Materials and Methods:

Materials and Methods Primer design and analysis In order to detect HBoV full genomes, specific oligonucleotide primers were designed. The HBoV full length has been obtained from the National Centre for Biotechnology information (NCBI) (www. ncbi.nlm.nih.gov ). Primer design has been carried out by the use of primer 3 software ( http://www. genome.wi.mit.edu/cgi -bin/primer/ primer3-www.cgi). Alignment of the HBoV strains genome has been carried out by the use of Bioedit software program ( http://www.bioedit.com ). Hussein Sabit, Ph.D

Slide 20:

Primers name Primers Sequence AT EPS (bp) LNS 1st 200-620 F 5 - CCACGCTTGTGGTGAGTCTA3 - 58 °C 247 1st _200-620_ R 5 - CCCAAAATGGCGATCTTCTA3 - 2nd _ 820-1320_ F 5 - CAGTGGATCCTCTTCGCTTC3 - 58 °C 213 2nd _820-1320_ R 5 - GCCCTGGAATGACTTCGTTA3 - Oligonucleotide primers used in this study Hussein Sabit, Ph.D

Real time-PCR analysis: :

Real time-PCR analysis: Detection and quantification of HBoV positive control sample (obtained from Dr. Tobias Allander, Karolinska University Hospital, Stockholm, Sweden) has been carried out. The reaction consists of Buffer (10x), MgCl 2 (50mM), dNTP's (10mM), forward primer (20µM), reverse primer (20µM), SYBR Green dye 0.25 µl per reaction ( Invitrogen , USA). Machine program ( Miniopticon , Biorad , USA): 5 min at 95 °C for activation of Taq DNA polymerase enzyme, followed by 40 cycles for amplification with a denaturing step at 95 °C for 15 sec., gradient annealing temperatures (from 55- 65 °C) were used. Fixed extension step 1 min and at 72 °C was used. Four DNA concentrations were used in this study; 17 Million Viral copies, 1.7 Million copies, 0.0017 Million copies, and 0.00017 Million copies. Hussein Sabit, Ph.D

Conventional PCR analysis:

Conventional PCR analysis A conventional PCR was performed to to ensure the obtained data. Agarose gel electrophoresis was performed to separate the obtained bands. The resulted pattern was viewed on UV-transilluminator after being stained with ethidium bromide. The PCR conditions were as follows: 94°C for 9 min, followed by 35 cycles of 94°C for 1 min, 54°C for 1 min, and 72°C for 2 min. Hussein Sabit, Ph.D

Results:

Results Oligonucleotide primer analysis Designed oligonucleotide primers have been tested against the HBoV genome by using Bioedit bioinformatics software. The results showed that the designed primers have been matched successfully to the HBoV genomes. Hussein Sabit, Ph.D

Slide 24:

(Figure 1): B ioinformatics analysis of the designed primers. Hussein Sabit, Ph.D

Slide 25:

Strains name gi|77125236|ref|NC_007455.1| Human bocavirus, complete genome gi|161137737|gb|EU262979.1| Human bocavirus isolate CU74W, complete genome gi|161137732|gb|EU262978.1| Human bocavirus isolate CU8N, complete genome gi|149389721|gb|EF450740.1| Human bocavirus isolate HK24, complete genome gi|149389716|gb|EF450739.1| Human bocavirus isolate HK23, complete genome gi|149389711|gb|EF450738.1| Human bocavirus isolate HK22, complete genome gi|149389706|gb|EF450737.1| Human bocavirus isolate HK21, complete genome gi|149389701|gb|EF450736.1| Human bocavirus isolate HK20, complete genome gi|149389696|gb|EF450735.1| Human bocavirus isolate HK19, complete genome gi|149389691|gb|EF450734.1| Human bocavirus isolate HK18, complete genome gi|149389686|gb|EF450733.1| Human bocavirus isolate HK17, complete genome gi|149389681|gb|EF450732.1| Human bocavirus isolate HK16, complete genome gi|149389676|gb|EF450731.1| Human bocavirus isolate HK15, complete genome gi|149389671|gb|EF450730.1| Human bocavirus isolate HK14, complete genome gi|149389666|gb|EF450729.1| Human bocavirus isolate HK13, complete genome gi|149389661|gb|EF450728.1| Human bocavirus isolate HK12, complete genome gi|149389656|gb|EF450727.1| Human bocavirus isolate HK11, complete genome gi|149389651|gb|EF450726.1| Human bocavirus isolate HK10, complete genome gi|149389646|gb|EF450725.1| Human bocavirus isolate HK9, complete genome Examples of HBoV strains used for the bioinformatics analysis in this study. Hussein Sabit, Ph.D

A sensitivity tests were performed to assess the cycle threshold (Ct) against the four DNA concentration used with primer pair LSN1 and LNS2. :

A sensitivity tests were performed to assess the cycle threshold (Ct) against the four DNA concentration used with primer pair LSN1 and LNS2. Annealing Temperature ºC Template Conc. C.t. 55 17 Million copy 13.47 58 17 Million copy 13.39 60 17 Million copy 13.46 63 17 Million copy 13.65 65 17 Million copy 14.06 55 1.7 Million copy 17.87 58 1.7 Million copy 17.08 60 1.7 Million copy 17.28 63 1.7 Million copy 17.19 65 1.7 Million copy 17.51 55 0.17 Million copy 21.68 58 0.17 Million copy 21.08 60 0.17 Million copy 21.17 63 0.17 Million copy 21.25 65 0.17 Million copy 21.41 55 0.017 Million copy 24.5 58 0.017 Million copy 24.18 60 0.017 Million copy 24.37 63 0.017 Million copy 24.47 65 0.017 Million copy 25.14 Annealing Temperature º C Template conc. C.t. 55 17 Million copy 14.51 58 17 Million copy 14.09 60 17 Million copy 14.13 63 17 Million copy 14.44 65 17 Million copy 14.77 55 1.7 Million copy 18.08 58 1.7 Million copy 16.91 60 1.7 Million copy 27.2 63 1.7 Million copy N/A 65 1.7 Million copy 18.23 58 0.017 Million copy 23.74 60 0.017 Million copy N/A 63 0.017 Million copy 25.07 65 0.017 Million copy 26.3 55 0.0017 Million copy 28.92 58 0.0017 Million copy 28.46 60 0.0017 Million copy 27.81 63 0.0017 Million copy 27.29 65 0.0017 Million copy 28.2 Table (4): Sensitivity test of the examined annealing temperature with primer LNS2 . Table (3): Sensitivity test of the examined annealing temperature with primer LNS1 Sensitivity tests Hussein Sabit, Ph.D

Figure (2) and Figure (3) demonstrate Sensitivity test of primer LNS1 and LNS2 at the annealing temperature of 58 °C. :

Figure (2) and Figure (3) demonstrate Sensitivity test of primer LNS1 and LNS2 at the annealing temperature of 58 °C. (Figure 2): Sensitivity test of primer LNS1 at the annealing temperature of 58 °C . (Figure 3): Sensitivity test of primer LNS2 at the annealing temperature of 58 °C . Sensitivity test at 58 ° C Hussein Sabit, Ph.D

Slide 28:

In silico PCR analysis showed that the designed primer has a fixed annealing temperature of 58 °C. In vitro analysis showed that the annealing temperature was variable according to the DNA concentration The data obtained indicated that using both primers LNS 1 & LNS2, the annealing temperature was 58 °C . (LNS 1 had some deviation in the fourth concentration). Hussein Sabit, Ph.D

Real Time PCR analysis:

Real Time PCR analysis The results (indicated as cycle threshold (Ct) values) showed that the primer LNS2 was better (Ct 13.39). Sensitivity analysis indicated gradient increase in the Ct in response to the gradient decrease of the DNA concentration. Also, the primers LNS1 and LNS2 were capable of detecting concentrations down to 0.0000017 µg and 0.000017 µg, respectively. Primer 55 °C 58 °C 60 °C 63 °C 65 °C LNS1 14.51 14.09 14.13 14.44 14.77 LNS2 13.47 13.39 13.46 13.65 14.06 Table (5): Ct values of the designed primers at the selected annealing temperatures. Hussein Sabit, Ph.D

Conventional PCR analysis:

Conventional PCR analysis Conventional PCR was performed to ensure the data gained by the real time PCR and in slico PCR. The obtained data ( Figure 5 and Figure 6 ) showed that using the primer sets for LNS1 and LNS 2 amplified a fragment with the expected molecular weight (247 bp and 213 bp, respectively). Hussein Sabit, Ph.D

Agarose gel electrophoresis:

Agarose gel electrophoresis To visualize the obtained results, ten microliters of each amplified product was loaded in an agarose gel (2.5%) containing 0.5 ug /ml ethidium bromide and then electrophoresed. After the electrophoresis the DNA, bands were visualized by UV-transilluminator. The data generated was photographed and then subjected to analyses by Gel documentation system (Gel Pro Analyzer version 3.1). Hussein Sabit, Ph.D

Conclusion:

Conclusion The oligonucleotides primers have been designed based on the sequence alignment analysis, so absence of any mismatches was expected. Designed primers have been tested against the whole length genome of HBoV genome and an informative patterns have been obtained. A sensitivity tests were performed to assess the Ct values and to assess also the best annealing temperature (55-65º C) against the four viral DNA concentrations Hussein Sabit, Ph.D

Slide 33:

The data indicated that the optimum annealing temperature is 58 º C. This may be in disagreement with the findings obtained with the in silico PCR which determined the optimum annealing temperature of 55 º C. However the designed primers LNS1 and LNS2 might be used in PCR amplification likewise in sequencing. Xiaoming et al., (2006). Cont. Hussein Sabit, Ph.D

Slide 34:

The RT-PCR proved to be sensitive, specific, and reliable for HBoV DNA amplification and quantification. Although in silico PCR analysis recommended the use of 55 °C as an annealing temperature, in vitro experiments showed that the best annealing temperature is 58 °C. Because the amplified PCR fragment in the real-time PCR is shorter than in the conventional PCR, the real-time PCR may appear more sensitive. Cont. Hussein Sabit, Ph.D

Finally ..:

Finally .. Viral diagnostics is a dynamic field with potential for significant impact on public health practice. It impacts on: Surveillance of respiratory viruses Understanding epidemiology of respiratory viruses Infection control Antiviral therapy and other clinical management of patients with viral infection. New applications of molecular technology are being introduced continuously Moving towards point of care application of advanced diagnostics. Hussein Sabit, Ph.D

Acknowledgement:

Acknowledgement We would like to thank the Ministry of Cooperation of Luxembourg  for supporting the training of on PCR at the Institute of Immunology, CRP-Santé/LNS, Luxembourg. Deep gratitude to Faculty of Biotechnology, Misr University for science and Technology, for their encouragement and support. Hussein Sabit, Ph.D

Selected References:

Selected References Allander T (2008). Human bocavirus. Journal of Clinical Virology 41, 29–33. Allander T, Tammi,MT , Eriksson M, Bjerkner A, Tiveljung-Lindell A, Andersson B (2005). Cloning of a human parvovirus by molecular screening of respiratory tract samples. Proc Natl Acad Sci USA; 102: 12891–6. Kleines M, Simone S, Annette R, Klaus R, and Martin H (2007). High Prevalence of Human Bocavirus Detected in Young Children with Severe Acute Lower Respiratory Tract Disease by Use of a Standard PCR Protocol and a Novel Real-Time PCR Protocol. J. Clin.Microbiol . pp. 1032–1034 Vol. 45, No. 3. Pérez-Trallero E, Vicente D, Cilla G, Montes M, and Pérez-Yarza EG, (2007). Human bocavirus, a respiratory and enteric virus. Emerg . Infect. Dis.13: 636-637. Neske F, Kerstin B, Franz T, Joärg S, Axel R, Hans WK, and Benedikt W (2007). Real-Time PCR for Diagnosis of Human Bocavirus Infections and Phylogenetic Analysis. JOURNAL OF CLINICAL MICROBIOLOGY, July 2007, p. 2116 2122 Vol. 45, No. 7. Hussein Sabit, Ph.D

Slide 38:

Hussein Sabit, Ph.D