Protandim Product and Biz Power Point-3-7-12

Category: Entertainment

Presentation Description

No description available.


By: drnielson (65 month(s) ago)

How can I get a copy of your PPT. It is Awesome!!

Presentation Transcript

Protandim & True science :

Protandim & True science Carol Bruckler and Marc Dozier Welcome You! scentifichealth

Healthy Living Do you feel like these people?:

Healthy Living Do you feel like these people?

Or, is this your reality?:

Or, is this your reality? Plop-Plop Fizz-Fizz?? Feeling a little stressed out?

What you put into your body does matter!:

What you put into your body does matter! Our bodies are so run down and antioxidant deficient that we constantly reach for stimulants to get through the day! We feed our bodies toxic, “foods” that leave our cells depleted of the nutrients they so desperately need!

Unhealthy lifestyles cause oxidative damage:

Unhealthy lifestyles cause oxidative damage Alcohol and Smoking cause oxidative damage to the body

Even healthy lifestyles cause oxidation. It’s a natural process.:

Even healthy lifestyles cause oxidation. It’s a natural process. Exercise causes oxidative stress Even healthy sunshine causes oxidation

So, what do we do with all this Oxidation? Or rather, what does IT do inside our bodies?:

So, what do we do with all this Oxidation? Or rather, what does IT do inside our bodies?

Free Radicals damage …:

Free Radicals damage … Skin Aging Sunburn, Psoriasis Dermatitis, Melanoma

Our lifestyles affect our cells. Our cells affect the quality of our lives. They are our lives.:

Our lifestyles affect our cells. Our cells affect the quality of our lives. They are our lives. You are made up of more than 100 TRILLION cells! Free Radicals steal negative electrons from healthy cells

There are over 95,000 Peer-Reviewed Studies on the U. S. Library of Medicine National Institute of Health website  about how damaging Oxidative Stress is for our cellular health.:

There are over 95,000 Peer-Reviewed Studies on the U. S. Library of Medicine National Institute of Health website about how damaging Oxidative Stress is for our cellular health.

So, where does this leave us?:

So, where does this leave us? Running to the doctor or the Health Food Store for a solution?

Diseases and Deaths Annually:

Diseases and Deaths Annually Today, in America alone … 39,000 people die a year due to unnecessary surgery and other errors in hospitals. ~Journal of the American Medical Association JAMA 80,000 people die from infections caught in hospitals. ~ JAMA 106,000 people die from adverse drug reactions. ~JAMA 652,486 die of Heart Disease. ~ Center for Disease Control 553,888 die of Cancer. ~ American Cancer Society 26 Million people have Diabetes. ~ Center for Disease Control 63% Adults are considered overweight/obese. 16.9 % Children between 2-19 are considered obese How are we doing?

So how do our bodies fight back against free radical damage?:

So how do our bodies fight back against free radical damage? They use Antioxidants

What are Antioxidants? Negatively charged Ions. What do they do?:

What are Antioxidants? Negatively charged Ions. What do they do?

How many pills do we have to take to meet our antioxidant requirement?:

How many pills do we have to take to meet our antioxidant requirement? Assorted antioxidants neutralize ONLY ONE Free Radical Molecule each! Will my medications do the trick?

The answer…:

The answer… Your answer!!!

Protandim Antioxidant Therapy Clinically Proven to Reduce Free Radical Damage:

Protandim Antioxidant Therapy Clinically Proven to Reduce Free Radical Damage Conventional or direct antioxidants can neutralize ONLY ONE Free Radical Molecule. Protandim triggers the creation of enzymes that ELIMINATE up to ONE MILLION Free Radical Molecules Per Second, 24 Hours a Day, without being depleted. Protandim is the only supplement clinically proven to reduce oxidative stress by an average 40% , slowing down the cell aging process to the level of a 20 year-old .

Protandim :

Protandim ● Protandim is Completely Validated by Science with 10 Peer-Reviewed studies, 4 Patents and the billions of dollars have been spent on Independent Research at over 25 universities in the United States and around the World. ● Oxidative stress increases with age and is associated with nearly 200 diseases. You have seen it at work when you see a piece of fruit turn brown when exposed to air on your kitchen counter. ● Protandim is the only product clinically proven to reduce oxidative stress by 40% in just 30 days! ● Protandim has been featured on ABC, NBC, PBS and described by the CNN Chief Medical Correspondent, Dr. Sanjay Gupta’s book “Chasing Life,” and an article about Dr. Joe McCord’s research and discovery in The Wall Street Journal.

Protandim :

Protandim There are trillions of cells in the human body and all of those cells, including the DNA in your cells, are relentlessly attacked by free radicals with every breath you take every second of every day. Protandim neutralizes and destroys free radicals. There are 300,000,000,000,000,000,000,000 destructive free radical attacks on your cells everyday. Protandim (a Nrf2 activator) triggers a massive replication of the enzymes of your genes - 1 million times every second, everyday for each of 400 to over 1,000 special genes called survival genes. These survival genes perform unique tasks (up and down regulating the innate capability of your genes) depending upon what is needed for your cells to survive and thrive.

Protandim :

Protandim Protandim is a Nrf2 activator. Nrf2 is a transcription factor in your body, which means it signals the expression of your genes . Inside our cells Nrf2 molecules are activated by Protandim, they turn up (up regulate) or turn down (down regulate) just like a dimmer switch the innate abilities of each gene in our body and encode three types of genes that help your cells survive trauma: 1) anti-oxidant genes and enzymes- to reduce oxidative stress from free radicals 2) anti-inflammatory genes- to reduce inflammation and 3) anti-fibrotic genes. Survival genes perform unique tasks (up and down regulating the innate capability and expression of the cells) depending upon what is needed to maintain healthy functioning cells.

Protandim :

Protandim Examples of Nrf2 Gene Expression: When you cut yourself, the genes that help your wound heal are fibrotic, they help close the wound to stop the bleeding and reduce infection. On the other hand, fibrotic genes inside your internal organs, like your heart (is called heart failure) or in your lungs (is called Pulmonary Fibrosis) which will lead to death.

Protandim :

Protandim Protandim spurs Nrf2 activators in your cells and the Nrf2 molecules travel to where the DNA is stored. DNA is the central blue print of all your genes and controls everything you are and everything the body can produce. Nrf2 regulates the 400 to over 1,000 survival genes of the total number of 25,000 genes. Nrf2 activators send chemical messages (like controlling the dimmer switch on a lamp) to the anti-oxidant enzymes to replicate themselves 1,000,000 times every second of every hour, 24/7 to fight free radicals and up and down regulate anti-inflammatory and anti-fibrotic genes to maintain proper and normal functioning of all your cells and the internal organs of your body.

Patents :

Patents Protandim is protected by FOUR U.S. Patents 2007 - Patent #7,241,461 2008 - Patent #7,384,655 2009 - Patent #7,579,026 2011 - Patent #7,923,045 See more information at:

Patents :

Patents Protandim is protected by FOUR U.S. Patents See more information at

Protandim :

Protandim It's what's inside that counts! Protandim is comprised of five potent botanicals used in the ancient India and China for thousands of years - ingredients selected because they provide 1500 percent greater synergy working in tandem together than what they're able to achieve on their own, hence the name – Protandim.

Protandim :

Protandim Milk Thistle Extract (seed) - milk thistle is a flowering plant of the daisy family, native to Mediterranean regions of Europe, North Africa and the Middle East it seeds have been used for 2000 years to treat chronic liver disease and to protect the liver against toxins. Increasing research is being under taken on the psychological effects, therapeutic properties and possible medical uses of milk thistle.

Protandim :

Protandim Bacopa Extract (Aerial Parts) - Bacopa herb commonly grown in marshy areas throughout India has been touted for cognitive enhancing effects for centuries. It possesses strong antioxidant properties, protects mental function and helps improves learning skills.

Protandim :

Protandim Ashwagandha (Root) Ashwagandha root, a herb of the ages from the traditional medicine of India, is considered an ‘ adaptogen ’, a term used to describe herbs that improve physical energy and athletic ability, increase immunity to colds and infections and increase sexual capacity and fertility. Ashwagandha helps boost the immune system, helps alleviate stress and is also used to treat inflammation, improve memory and provide a rich source of antioxidants.

Protandim :

Protandim Green Tea Extract (Leaf) Green Tea originates from China and is associated with many cultures in Asia and the Middle East. It has been the subject of many scientific and medical studies to determine the extent of its long purported health benefits. Many people believe green tea helps lower the chance of heart disease and of developing certain types of cancer due to its flavonoids , a group of phytochemicals in most plant products that are responsible for such health effects as antioxidative and anticarcinogenic functions.

Protandim :

Protandim Turmeric Extract (Rhizome) Turmeric has always been an important part of Chinese herbal medicine and has also been used in India for 2,500 years. Truly, the health benefits of turmeric have been slowly revealing themselves over the centuries. This natural food is believed by many to support liver health, to help prevent bad cholesterol and it is currently being studied for its ability to prevent and block the growth of tumors.

Protandim :

Protandim Turmeric has attracted the attention of researchers in the fields of Alzheimer’s disease, memory deficits, arthritis, cancer (including breast cancer) and diabetes. It possesses anti-inflammatory and antioxidant properties and its antioxidant power is so effective it actually helps preserve the shelf life of foods it’s added to. : * Peer Reviewed Studies 2006 - Oxidative Stress Study 2008 - Glutathione Study 2009 – LSU - Skin Cancer Study 2009 - VCU Heart Disease Study – American Heart Assn. 2010 - Muscular Dystrophy Study 2010 - LSU Chemo-Preventive Study 2010 - OSU Bypass Graft Study 2011 - LSU Skin Cancer & MnSOD Study 2011 – Nrf2 Activation See more information at: * There are 20+ additional Peer Reviewed studies currently underway as of 2012 .


PEER REVIEWED STUDIES Anti-Aging Study: Protandim ® is the only product "Clinically Proven" to reduce oxidative stress by an average of 40%. (free radica boil med, 2006 Jan, 15;40 (2) 34 1-7): University of Colorado Cancer Study: Both skin tumor incidence and multiplicity were reduced in mice on Potandim ® diet by 33% and 57% respectively. ( PLos one 2009, 4 (4) e5284 Epub 2009 Apr 22): Louisiana State University Cardio Study: Protandim ® prevented the death of heart cells and lowered osteopontin (scar tissue) by 50%, a cause of heart failure. (Circulation, 2009 Nov 17, 120 (20) 1951-60 Epub Nov 2, 2009): Virginia Commonwealth University and Published in American Heart Association Journal “Circulation”


PEER REVIEWED STUDIES Neurological Study: Oxidative is a pertinent factor in Muscular Dystrophy. Protandim ® lowered oxidative stress by 48% and showed 38% less MRI signal abnormality. (j deit suppl. 2010 June 1: 7(2): 159-178): Harvard Medical School Nrf2 Activator: Protandim ® has the ability to activate Nrf2 transcription factor which switches on protective genes and switches off non protective genes. (Circulation, 2009 Nov 17, 120 (20) 1951-60 Epub Nov 2, 2009): Virginia Commonwealth University and Published in American Heart Association Journal “Circulation”


PEER REVIEWED STUDIES The therapeutic potential of Nrf2 activation study: Protandim ® modulates pathways involving not only antioxidant enzymes, but those related to colon cancer, cardiovascular disease and Alzheimer disease. ( Mol Aspects Med. 2011 Aug;(4-6): 234-46. Epub 2011 Oct 15): University of Colorado at Denver



True Science THE Anti-Aging Cream:

True Science THE Anti-Aging Cream Benefits ... Protandim Antioxidant Therapy in a Bottle Helps Increase Collagen Production for more supple, youthful skin Achieves Extreme Hydration through the use of advanced hydration technology Minimizes Appearance of fine lines and wrinkles Promotes Even Skin Tone for a youthful glow More Beneficial Ingredients than other skincare products on the market Your Skin Feels Clean and Silky

True Science THE Anti-Aging Cream:

True Science THE Anti-Aging Cream True Science ~ How It Works This new proprietary skin care formula was developed in association with Kimberly Stone, M.D., a leading Denver-based board certified dermatologist, and was formulated with more of the ingredients known to protect the skin from the bombardment of factors that contribute to aging and the symptoms of unhealthy skin.

True Science THE Anti-Aging Cream:

True Science THE Anti-Aging Cream The TrueScience proprietary skin care formula includes: Hydration/Moisturizing: TrueScience features a Lamellar Phase Emulsion System that forms a liquid emulsion barrier for superior moisturizing without a thick, oily feel. Moreover TrueScience also contains extracts of sandalwood, phellodendron bark and barley, all of which deliver exotic fatty acids to retain the body’s natural moisture and produce a high-end moisturizing effect. Finally, it also features sodium hyaluronate , which is a superior moisture-binding agent that can balance moisture levels at the surface of the skin.

True Science THE Anti-Aging Cream:

True Science THE Anti-Aging Cream The TrueScience proprietary skin care formula includes: Toning/Brightening: The turmeric extract in TrueScience is specially modified to remove the majority of yellow compounds without reducing the effectiveness of its potent curcuminoids . Curcuminoids have been shown to produce a gentle skin lightening that even dispigmentation . Additionally, the leucojum aestivum bulb extract slows the spread of melanocytes , which contribute to uneven skin coloring.

True Science THE Anti-Aging Cream:

True Science THE Anti-Aging Cream The TrueScience proprietary skin care formula includes: Wrinkles/Fine Lines: The palm peptides and leucojum aestivum bulb extract in TrueScience are all shown to visibly reduce signs of wrinkles and fine lines. They may also help promote a thicker epidermis and dermis for less skin transparency for improved tone and texture. All-Inclusive: Unlike most other skin care lines, the TrueScience anti-aging cream eliminates the need for an extra eye cream due to its wide ranging benefits.

True Science THE Anti-Aging Cream:

True Science THE Anti-Aging Cream The TrueScience proprietary skin care formula includes: Lipid Rejuvenation: TrueScience delivers multiple ingredients, including sandalwood oil, phellodendron bark extract, barley extract and a proprietary blend of glycolipids , soy phytosterols and hyaluronic acid to mimic the naturally occurring lipid structure in the skin and retain the body’s own moisturizing lipids.

True Science THE Anti-Aging Cream:

True Science THE Anti-Aging Cream Benefits ... Real Results in 56 Days Noticeably diminished fine lines / wrinkles Stimulated skin renewal for collagen synthesis Promoted collagen and elastin production Lightened and evened skin tone and pigmentation Day 1 - Before

DNA determines what and who you are.:

DNA determines what and who you are.

DNA determines what and who you are.:

DNA determines what and who you are. DNA is the blueprint of every cell in your body. DNA is found in the nucleus of every cell in your body. The DNA code in every cell is three billion letters long!! DNA is made up of four chemicals, abbreviated as letters A, T, G and C . These letters are arranged in the human cell like this: ATGCGTGCTGACTCGCTCCTGATC and so on. The order in which they are arranged instructs all our cell's actions.

DNA determines what and who you are.:

DNA determines what and who you are. Our genes are composed of DNA and are programmed to perform their proper function. Gene expression largely determines our health, our height and our hues. But you don’t have to stand idly by and wait for your genes to express themselves. We can synergize our genes through Protandim, a Nrf2 synergizer . A Nrf2 synergizer gives your cells a nudge on a genetic level to reach their potential — which in turn helps us reach our potential as healthy, energized and well-rested individuals. Protandim synergizes our traits and our potential. What’s in your genes?

DNA determines what and who you are.:

DNA determines what and who you are. What are Genes? Every cell in the human body contains at least 25,000 genes, which carry information that determine your unique traits . Traits are characteristics you inherit from your parents. Genes are composed of thread-like molecular material called chromosomes. Like chromosomes, genes come in pairs. Each of your biological parents has two copies of each of their genes, and each parent passes along just one copy to make up the genes you have. The chromosomes and genes are made of DNA, which is short for deoxyribonucleic acid.

DNA determines what and who you are.:

DNA determines what and who you are. How Do Genes Work? Your genes carry the blueprints — the instructions — for all our cells. All your genes have specific functions in your cells. Your genes also create proteins that are the building blocks of everything in your body. A protein that binds to specific DNA sequences and controls the transcription (or flow) of genetic information from DNA to mRNA is called the transcription factor. Nrf2 is a transcription factor in your body, which means it signals the expression of your genes. All the organs in your body are made up of proteins. Proteins help our bodies grow, work properly and stay healthy. Scientists estimate that each gene in the body may make as many as 10 different proteins. That's over 200,000 proteins!

DNA determines what and who you are.:

DNA determines what and who you are. It has been determined that 99.9% of your DNA is similar to everyone's genetic makeup.  What is uniquely you is found in the fractional difference in how those three billion letters are sequenced in your cells.

DNA determines what and who you are.:

DNA determines what and who you are. Your genes are not your destiny! Your genes are the bullets in a gun and your environment, (diet, stress, lifestyle, basic nutrition, products you take into your body…) pulls the trigger. Nutrigenomics : The study of how the things that you ingest (usually food products) into your body interact with genes, (DNA) to regulate gene expression. Epigenetics : The science of how the environment / lifestyle choices such as diet and drug use have lasting health consequences which can also affect the genetic inheritance of future generations.

DNA determines what and who you are.:

DNA determines what and who you are. Genome - The total amount of genetic information in the chromosomes in your body, including its genes and DNA sequences. Your DNA, genes and chromosomes are located in the nucleus. The nucleus is the brain of your cells. The nucleus is responsible for the metabolism, growth, and reproduction of your cells .

DNA determines what and who you are.:

DNA determines what and who you are. In humans, the nucleus contains 46 individual chromosomes or 23 pairs of chromosomes (chromosomes come in pairs) half of these chromosomes come from one parent and half come from the other parent. Twenty two of the pairs appear identical (these are called autosomes ); the other two chromosomes are called sex chromosomes — X and Y. Females have 2 X chromosomes while males have one X and one Y chromosome.

DNA determines what and who you are.:

DNA determines what and who you are. DNA and Protandim ~ The First Commercially Available Nrf2 Activator! Protandim is a Nrf2 activator. A Nrf2 activator is a protein messenger contained in every cell of the body that sends information to the cell’s DNA. When this protein messenger enters the nucleus, it turns on hundreds of the 25,000 genes we all have, which are collectively known as survival genes.

DNA determines what and who you are.:

DNA determines what and who you are. DNA and Protandim ~ The First Commercially Available Nrf2 Activator! Protandim activates the 400 to over a 1,000 survival genes, such as antioxidant genes, that keep us safe from free radicals and oxidants and also turns down genes that perpetuate inflammation and genes that encourage slow, progressive fibrosis to occur. Together, these actions provide a remarkable promise of protection from many kinds of age-related diseases.

PowerPoint Presentation:

Want to know more about Protandim and TrueScience Anti-Aging Skin Cream? TOPICS - How Protandim Works - The Antioxidant Myth - CLINICAL REPORT -ABC News Investigative Report - Frequently Asked Questions - FAQs GO TO and

Let’s meet the Expert…:

Let’s meet the Expert… Dr. Joe McCord, Ph.D. Founder LifeVantage

● World-renowned scientist, pioneer in free radical biology and the scientist behind Protandim, the Nrf2 Synergizer. ● Chief Science Officer of the LifeVantage Corporation Scientific Advisory Board. ● Devoted his life to the study of free radicals, their role in aging and the many problems associated with aging. ● Highly regarded in the field and has helped shape the direction of antioxidant research for over 40 years.:

Dr. Joe McCord, Ph.D. Founder LifeVantage ● World-renowned scientist, pioneer in free radical biology and the scientist behind Protandim, the Nrf2 Synergizer . ● Chief Science Officer of the LifeVantage Corporation Scientific Advisory Board. ● Devoted his life to the study of free radicals, their role in aging and the many problems associated with aging. ● Highly regarded in the field and has helped shape the direction of antioxidant research for over 40 years.

● Co-Discoverer of superoxide dismutase (SOD) in 1969, SOD is an essential enzyme that eliminates free radicals. His discovery of SOD marked the beginning of the study of antioxidants and the impact on the human body. This discovery is so significant that it has been mentioned in more than 46,000 peer-reviewed publications. ● For his work, Dr. Joe McCord was awarded the Elliott Cresson Medal from the Franklin Institute, presented to distinguished inventors and scientists, putting Dr. McCord in the same company as Pierre and Marie Curie, Alexander Graham Bell, Orville Wright and Henry Ford. :

Dr. Joe McCord, Ph.D. Founder LifeVantage ● Co-Discoverer of superoxide dismutase (SOD) in 1969, SOD is an essential enzyme that eliminates free radicals. His discovery of SOD marked the beginning of the study of antioxidants and the impact on the human body. This discovery is so significant that it has been mentioned in more than 46,000 peer-reviewed publications. ● For his work, Dr. Joe McCord was awarded the Elliott Cresson Medal from the Franklin Institute , presented to distinguished inventors and scientists, putting Dr. McCord in the same company as Pierre and Marie Curie, Alexander Graham Bell, Orville Wright and Henry Ford.

● Dr. Joe McCord serves as the head of the Division of Biochemistry and Molecular Biology at the Webb-Waring Institute; has been a member of the LifeVantage Corporation Board of Directors since 2006. :

Dr. Joe McCord, Ph.D. Founder LifeVantage ● Dr. Joe McCord serves as the head of the Division of Biochemistry and Molecular Biology at the Webb- Waring Institute; has been a member of the LifeVantage Corporation Board of Directors since 2006.


LifeVantage Founded 2003 Experienced Management Team Publicly Traded – LFVN Re-launched May 2009 as a Network Marketing company 2011 - $5 Million+ Monthly Sales

LifeVantage is “On Trend” Health, Baby Boomers, Financial Security:

LifeVantage is “On Trend” Health, Baby Boomers, Financial Security Health is the next Trillion Dollar Industry Baby Boomers : ● 76 Million born from 1946 – 1964 ● Strongest Economic Demographic Group ● Control over 2/3 of every dollar spent in U.S. ● Concerned about Cancer/other health issues ● Want to look young and feel healthy ● Anxious about Retirement/Financial Future ● Many have lost 50%+ of Retirement savings … and don’t have time to get it back.

Global Network Marketing Industry is Growing:

Global Network Marketing Industry is Growing ● 1990 – 56% of direct selling companies used MLM Plan ● 2006 – 83% of direct selling companies used MLM Plan ● 2012 - 49 million people – participate Globally ● By 2022 – More growth projected than previous 50 years ● 475,000 people join each week – Globally ● 175,000 people join each week – U.S. Only

Global Network Marketing Industry is Growing:

Global Network Marketing Industry is Growing 1990 – 56% of direct selling companies used MLM Plan 2006 – 83% of direct selling companies used MLM Plan 2012 - 49 million people – participate Globally By 2022 – More growth projected than previous 50 years 475,000 people join each week – Globally 175,000 people join each week – U.S. Only

PowerPoint Presentation:

Fiscal 2011 was a year filled with positive improvements and exciting new developments that enabled us to deliver record financial results. Our revenue grew to 39 million, 238% increase compared to fiscal 2010. Now is a great time to be associated with LifeVantage, whether as an employee, a distributor, a customer or a valued shareholder. We will work together to continue to grow our sales and operating income, to strengthen our balance sheet, and to build brand awareness.

It is easy to benefit from LifeVantage Products:

It is easy to benefit from LifeVantage Products Health: Become a “Preferred Customer” Save with Autoship at Wholesale Prices Protandim $ 40 - (Retail $ 55) True Science $ 70 - (Retail $ 85) OR ... 3

PowerPoint Presentation:

LifeVantage is a science-based company. LifeVantage Corporation is a Colorado corporation with offices in South Jordan, Utah and San Diego, California. We are a science-based company engaged in the identification, research, development, manufacture and distribution of an advanced nutraceutical dietary supplement, Protandim, and an anti-aging skin care product, TrueScience , to meet important health and wellness needs. We are focusing our ongoing research efforts on oxidative stress solutions, particularly the activation of Nuclear factor ( erythroid -derived 2)-like 2, also known as Nrf2, as it relates to cardiovascular, central nervous system, inflammatory and metabolic disease and other health related disorders.

PowerPoint Presentation:

Marketing and Direct Selling Opportunity with LifeVantage Direct selling through the network marketing sales channel has proven to be an effective method of marketing our science-based, high-quality products because our distributors can personally educate consumers on the science, quality and benefits of our products…Protandim and TrueScience Anti-Aging Skin Cream.

PowerPoint Presentation:

Growing Market Segments We Want to Reach We target our science-based products to several market segments: -         the Nrf2 Activator market; -         the oxidative stress market; -         the anti-aging market, for consumers who purchase cosmetics and dietary supplements and -   the independent distributor market.

PowerPoint Presentation:

LifeVantage - NOW is the Time Timing is Everything! Peter Drucker’s Business Curve Harvard Business School Momentum The time when 80% of the Money is Made Stabilization Time 3% to 5% Annual Growth Formulation and Branding 1 to 1 ½ years Less than 125,000 Distributors Unique Consumable. The Chance of a Lifetime 2012

It is easy to benefit from LifeVantage Products:

It is easy to benefit from LifeVantage Products Health: Become a “Preferred Customer” Save with Autoship at Wholesale Prices Protandim $ 40 - (Retail $ 55) True Science $ 70 - (Retail $ 85) OR ...

Maximize your benefits by becoming a Distributor :

Maximize your benefits by becoming a Distributor Health + Wealth – Become a Distributor Vantage Pack: $630 $ 535 in Products – (Protandim and/or True Science) Website (one time) $95 Starter Kit with marketing materials Monthly Training Series and so much more!

Maximize your benefits by becoming a Distributor :

Maximize your benefits by becoming a Distributor Qualify for 40% Commission and All Monthly Bonuses: $200 worth of purchases through your website Distributor (you) buy one bottle Protandim for $ 40 Your Personal Customers purchase $160 (combination of Protandim and/or True Science) Monthly Minimum Sales Volume $200

Maximize your benefits by becoming a Distributor :

Maximize your benefits by becoming a Distributor Quick Return on Investment Become a Distributor - Vantage Pack : $630 Includes 13 bottles of Protandim Sell 12 of your Vantage Pack Bottles @ $55 ea = $ 660 or … Enroll 3 Distributors @ $210 ea = $ 630 Do both and you just made $ 660!

PowerPoint Presentation:


PowerPoint Presentation:

1. FAST START BONUS Earn 40% on all Distributors and Personal Customers

PowerPoint Presentation:


PowerPoint Presentation:

Enroll 5 customers or Distributors whose cumulative volume is $500 or more. 3. FAST START BONUS POOL Paid Monthly

PowerPoint Presentation:

OV = Organization Volume per Month

PowerPoint Presentation:


PowerPoint Presentation:

5. GENERATIONAL MATCHING BONUS Paid Monthly Earn 10% match on Royalty checks of your personal enrollments. Earn an additional 5% on next 4 generations of personal enrollments.

PowerPoint Presentation:

Earn an additional 5% on next 4 generations of personal enrollments 6. ELITE POOL Paid Monthly 4% of total global commissionable sales are put into a pool and are paid to Qualified Elite Pro 7 Through Master Pro 10 distributors. You Share in Worldwide Sales

Thank you!:

Thank you!

authorStream Live Help