Genetic Engineering

Views:
 
     
 

Presentation Description

No description available.

Comments

Presentation Transcript

Slide 1:

Goooooooood MoornigGGGGG !

Genetic Engineering:

Genetic Engineering Dinesh D. Khedkar Department of Botany NAAC Reaccredited “A” - “Very Good” Grade Shri Shivaji Science College A College with Potential for Excellence (CPE) Amravati, Maharashtra - 444 603 Phone No.: 0721-2660855 Fax: 0721-2665485 e-mail : ati_shivaji@sancharnet.in Web site : www.shivajiscamt.dataone.in

GOLDEN RICE:

GOLDEN RICE

GOLDFISH:

GOLDFISH

MAIZBANA:

MAIZBANA

DOLION:

DOLION

LEMURAT:

LEMURAT

FIRE FLY : FIRE TOBACCO:

FIRE FLY : FIRE TOBACCO

Slide 18:

HOW? WHAT? WHICH? WHEN? WHERE? WHEN? WHY? Genetically Modified Organisms

Genetic Engineering:

Genetic Engineering

Slide 20:

phenotypic expression genome

What are GMOs?:

What are GMOs?

Slide 23:

6) As the tiny new plants grow, the carrot gene converts the tomato's pigment into beta-carotene, creating an enhanced tomato. 5) The tomato cells grow and divide in a culture with hormones that encourage the cells to become new shoots and roots. 4) The Agrobacterium transfers the carrot gene to the cells of tomato leaves in a petri dish . 3) The plasmid is reintroduced into the Agrobacterium. 2) They insert the carrot gene into a plasmid . 1) Scientists copy a carrot gene converts a pigment to beta-carotene.

Slide 24:

Transgenesis Process

engineering:

engineering Technology- Rka = Kku Use of Knowledge or Mechanical Art and Applied Science for Humanity. Engineering Creation of Engines Application of science to design, device & use of Machine Engine Mechanical device of different parts working together

Engineering Streams :

Engineering Streams Civil Mechanical Electronic Electrical Computer ……………………………..

Engineering : Genetics:

Engineering : Genetics Engineering: Coordination of Principles Genetics: Universal Principle of Working Genes: Intrinsic capability of the organism Genome: Genes: DNA: Nitrogen Bases Universally same: Microbes, Plants & Animals

Universality:

Universality Components Replication Expression Regulation

Engineering : Genetics:

Engineering : Genetics Engineering: Coordination of Principles Genetics: Universal Principle of Working Since last 25 years Genetics becomes Technology, Manipulating genes for desired behaviour of living organism like a Machine

Methodology:

Methodology Targeting: Host & Desired Trait Gene Isolation Gene Preparation Cloning into Vector Introduction in to Host Cell Selection of Transformed Cells Characterization of GMOs

Methodology:

Methodology Targeting: Host & Desired Trait Gene Isolation Gene Preparation Cloning into Vector Introduction in to Host Cell Selection of Transformed Cells Characterization of GMOs

Tools:

Tools Gene Isolation: Molecular Scissor Gene Amplification: Cloning / PCR Carriers: Vectors Gene Transfer Identification: Morphology / Markers

Tools:

Tools Gene Isolation: Molecular Scissor Gene Amplification: Cloning / PCR Carriers: Vectors Gene Transfer Identification: Morphology / Markers

Molecular Scissor:

Molecular Scissor Restriction Enzymes

Nathan, Smith & Arber:

Nathan, Smith & Arber Werner Arber – Postulates RE Hamilton Smith (1931) Purified one RE Daniel Nathans (1928, 1999) constructed the first genetic map using RE

Slide 36:

Restriction Modification System Defense System – RM System A Pathogen entering in any living system can be defended through Restriction System Own genome is Protected by Modifications in genome by DNA Methylation

Restriction Enzymes:

Restriction Enzymes Types: Restriction Exonucleases Cutting DNA at its Phosphate Backbone 2.Restriction Endonucleases Internal as well as External Cutting Working of RE

Restriction Exonucleases:

Restriction Exonucleases Enzymes cutting DNA at backbone of DNA Distant site of Recognition Eg . DNA Polymerase II (3 – 5) DNA Polymerase I (5 – 3) & (3 – 5)

Restriction Endonucleases:

Restriction Endonucleases Enzymes producing internal cuts in DNA Cuts DNA in or near recognition sites Eg . Type I Type II Type III

Restriction Endonucleases:

Restriction Endonucleases Type I Complex Endonucleases Recognition Sequences ~ 15 BP Bifunctional (R & M) Cleaves DNA about 1000 BP away from 5’ end of sequence “TCA” located with R Site Ex. Eco K, Eco B, etc.

Restriction Endonucleases:

Restriction Endonucleases

Restriction Endonucleases:

Restriction Endonucleases Type III Intermediate type Cleaves DNA in immediate vicinity of R Site Bifunctional EX. Eco PI, Eco 15 ( E. coli)

Restriction Sites (Recognition Sequences):

Restriction Sites (Recognition Sequences) They are Palindromic Sequences 5’ G A A A A G 3’ They may be palindrome with Rotational Symmetry G A A TTC CTT A A G They are GC rich

Tools:

Tools Gene Isolation: Molecular Scissor Gene Amplification: Cloning / PCR Carriers: Vectors Gene Transfer Identification: Morphology / Markers

Gene Amplification:

Gene Amplification Gene Cloning (Bacteria as a Machine) Polymerase Chain Reaction (PCR) Machine makes Multiple copies

Gene Amplification:

Gene Amplification Gene Cloning

PCR:

PCR PCR is the in vitro enzymatic synthesis and amplification of specific DNA sequences. Can amplify one molecule of DNA into billions of copies in a few hours PCR Kary Mullis Kary received a Nobel Prize in chemistry in 1993, for this invention

Slide 52:

Detection of chromosomal translocations Amplification across a translocation sequence Chromosome painting Detection of residual disease Infectious disease Forensics PCR

Tools:

Tools Gene Isolation: Molecular Scissor Gene Amplification: Cloning / PCR Carriers: Vectors Gene Transfer Identification: Morphology / Markers

Vectors:

Vectors Extra-chromosomal , Double Stranded, Circular, Autonomous DNA with ori site & Marker Genes . Types: I. Cloning vectors II. Expression Vectors

Properties of Good Vectors:

Properties of Good Vectors

Vector Types:

Vector Types

Plasmid:

Plasmid Single Copy – 1 Copy per Cell Multiple Copy - 10 – 20 Copies per Cell

Plasmid - Types:

Plasmid - Types F- Plasmids – Responsible for Conjugation R- Plasmid – Resistance genes for antibio. Col- Plasmid – Immune Protein Producing (Colicin)

Plasmid - Properties:

Plasmid - Properties Minimum amount of DNA Relaxed Replication At least Two selectable markers Multiple Recognition Sites R- sites within genes Viz. pBR322, 327; pCR1; pACY 177; pUC

Plasmid pBR 322:

Plasmid p BR 322 Plasmid discovered by Boliver & Rodriguez Derived from E. coli 4362 bp DNA Two markers – Tetracyclin & Ampicilin 12 restriction sites nic – bom region for mobilization poison sequence interfere other’s replication

Slide 61:

Plasmid p BR 322 - Map the replicon rep responsible for the replication of plasmid rop gene coding for the Rop protein, which promotes conversion of the unstable RNA I - RNA II complex to a stable complex and serves to decrease copy number bla gene , coding for beta-lactamase that confers resistance to ampicillin tet gene , encoding tetracycline resistance protein

Bacteriophages:

Bacteriophages Phage λ (Lambda) (Ds) & Phage M 13 (Ss) are extensively used vectors Phages attacking bacteria Lytic and Lysogenic Phages

Phage Lambda Vector:

Phage Lambda Vector Genome 48502 BP Ori site Lysogenic cycle genes occupy around 20 kb of DNA It has stuffer and essential genes Key regulator genes Marker genes Restriction sites

Phage Lambda Vector:

Phage Lambda Vector Insert (10 Kb) can introduce in stuffer region Key regulators – cro, N, Q, C I (repressor), C II, C III, for lytic and lysogenic cycle Transcription initiator – att, int and xis Recombination site – att C I – Lambda repressor Marker Genes - gam and red Q P Cos A 0 10 20 30 40 50 Stuffer DNA O att, int, xis N C I red – gam

Cosmids :

Cosmids Cosmids are essentially plasmids containing minimum of 250 bp of Lambda DNA which includes cos region, marker gene and restriction sites Long DNA (45 kbp ) can be introduced Infect like bacteriophage Selection is easy Amplification is easy Used in making gene library pJBB (J. Collins and B. Hohn , 1978 = 5.4 kb cosmid )

Cosmids :

Cosmids Ori Amphicilin r Tetracyclin r Cos site from Lambda DNA BamHI PstI PvuJ SalI

Recombinant DNA:

Recombinant DNA Insertion of Isolated DNA in to Vector needs restriction enzyme Construction of r – DNA (Recombinant Vector)

Gene source:

Gene source Living organism Gene machine Gene Library Genomic DNA Library c DNA Library

Genomic Dna library:

Genomic Dna library It’s a collection of recombinant DNA molecules containing entire genomic DNA of an organism.

Genomic Dna library Construction:

Genomic Dna library Construction

Genomic Dna library:

Genomic Dna library Construction: Extraction of entire genomic DNA Restriction Digestion (Simple / Mixed) Mechanical shearing Sonication Restriction enzymes

Genomic Dna library:

Genomic Dna library Construction: Extraction of entire genomic DNA Restriction Digestion (Simple / Mixed) Separation of fragments of equal size Electrophoresis Density gradient centrifugation

Genomic Dna library:

Genomic Dna library Libraries: Organism Genome size Fragments (Clones) E. Coli 3.75 X 10 3 kb 1157 Yeast 1.5 X 10 4 kb 3462 Drosophila 1.65 X 10 5 kb 38000 Human 3 X 10 9 kb 6,90,819

Genomic Dna library Applications:

Genomic Dna library Applications

C (Complementary) Dna library:

C (Complementary) Dna library It’s a gene library consists of only those region of the genome which are expressed. It’s a DNA library constructed from the m RNA Its representation of the genes under expression

C (Complementary) Dna library:

C (Complementary) Dna library mRNA Reverse transcription mRNA – DNA Hybrid RNA Degrad n (Alkali) Single Stranded DNA with hook DNA Polymerization Double Stranded DNA with Loop Reverse Transcriptase AUGCGCGAUCGACGUCCAAAAA TTTTTT 5’ 3’ Priming with Oligo dT AUGCGCGAUCGACGUCCAAAAA TACGCGCTAGCTGCAGG TTTTTT 5’ 3’ 3’ 5’ ATCGCGCTAGCTGCAGG TTTTTT 3’ 5’ ATCGCGCTAGCTGCAGG TTTTTT TAGCGCGAUCGACGTCCAAAAA

C (Complementary) Dna library:

C (Complementary) Dna library S I Nuclease cleaves Hook Double Stranded DNA Vector Cloning Recombinant Vector with C – DNA Placed in Bacteria Double Stranded DNA with Loop ATCGCGCTAGCTGCAGG TTTTTT TAGCGCGAUCGACGTCCAAAAA ATCGCGCTAGCTGCAGG TTTTTT TAGCGCGAUCGACGTCCAAAAA 3’ 5’ 5’ 3’

C (Complementary) Dna library:

C (Complementary) Dna library Application: Only desired genes are preserved Smaller than the genomic DNA Library Intron less gene structure As RNAs are small sized it can placed in normal vector Expression vector / cloning vectors can be used

C (Complementary) Dna library:

C (Complementary) Dna library Limitations: Heterogenous (Time of gene expression will decide) All genes are never in action at any time Processed RNA is used hence no similar sequences in DNA RNAs are having very short life span C – DNAs are blunt ended hence requires linker or adapter DNA molecules

Selection of Transformants:

Selection of Transformants Morphological Observations - Tagging Antibiotic Resistance ( amp r , tet r ) Marker Gene (FGP, LUX) Electrophoresis Hybridization Chromatography Electrophoresis

Tools:

Tools Gene Isolation: Molecular Scissor Gene Amplification: Cloning / PCR Carriers: Vectors Gene Transfer Identification: Morphology / Markers

Slide 83:

There are two main types of transformation i) Direct Method or Vectorless method of gene transfer Generally, there are 9 ways for gene transfer: (as published by Sambrook, 2001). (1) Chemical method, (2) Electroporation, (3) Particle gun method (4) Lipofection, (5) Microinjection, (6) Macro injection (7) Pollen transformation, (8) Laser transfection, (9) Gene transfection enhanced by elevated temperature . ii) Indirect or Vector-mediated Gene Transfer 1) Co-culture with tissue explants. 2) in plants transformation Gene Transfer

Slide 84:

Gene Gun DNA vector is coated onto gold or tungsten particles Particles are accelerated at high speeds by the gun Particles enter plant tissue DNA enters the nucleus and incorporates into chromosome Integration process unknown PSD-1000/He Particle Delivery System

Gene Gun:

Gene Gun Helios Gene Gun

Slide 86:

6) As the tiny new plants grow, the carrot gene converts the tomato's pigment into beta-carotene, creating an enhanced tomato. 5) The tomato cells grow and divide in a culture with hormones that encourage the cells to become new shoots and roots. 4) The Agrobacterium transfers the carrot gene to the cells of tomato leaves in a petri dish . 3) The plasmid is reintroduced into the Agrobacterium. 2) They insert the carrot gene into a plasmid . 1) Scientists copy a carrot gene converts a pigment to beta-carotene. Indirect or Vector-mediated Gene Transfer Agrobacterium mediated Gene Transfer

Slide 87:

Agrobacterium Causal agent of Crown Gall disease Rod shaped, Gram negative soil bacterium Symptoms are caused by the insertion of a small segment of DNA (known as the T-DNA, for 'transfer DNA') into the plant cell, which is incorporated at a semi-random location into the plant genome. Tumor producing Agrobacterium are parasitic and do not benefit the plant. The wide variety of plants affected by Agrobacterium makes it of great concern to the agriculture industry Economically, it is a serious pathogen of grape vines, stone fruits, nut trees, sugar beets, horse radish and rhubarb.

Slide 88:

Agrobacterium A natural DNA delivery system A plant pathogen found in nature Hormone genes expressed and galls form at infection site Delivers DNA that encodes for plant hormones Infects many plant species Gall on stem Gall on leaf DNA incorporates into plant chromosome

Slide 89:

The Galls Can Be Huge

Slide 91:

Action of Agrobacterium

Slide 92:

Ti Plasmid Ti (Tumor Inducing) plasmid – Reported in 1974 by Hamilton and his team Very huge, circular, double stranded, conjugative, megaplasmid of ~ 200 Kbp Contains transposable T – DNA Oncogene , Opine genes , Virulence genes , Ori site and Restriction sites

Slide 93:

Ti Plasmid

Slide 94:

T - DNA LB tms tmr tml onc nor RB 25 BP 25 BP 15 to 23 KBP LB / RB = Right and Left Border sequences tms = Tumor Morphology Shoot (Auxine) tmr = Tumor Morphology Root (Cytokinine, isopentyl adenine) tml = Tumor Morphology onc = Oncogene nor = Opine genes (Octopine, Nopaline)

Slide 95:

r i - Plasmid Ri (Root Inducing) plasmid – Agrobacterium rhizogenes

Slide 96:

T - DNA LB Rol f RolD tms tmr tml agn map RB 20 BP 20 BP 15 to 23 KBP LB / RB = Right and Left Border sequences tms = Tumor Morphology Shoot (Auxine) tmr = Tumor Morphology Root (Cytokinine, isopentyl adenine) tml = Tumor Morphology agn = Agropine map = Manopine

Slide 105:

THANKS!

authorStream Live Help