DNA to RNA

Views:
 
Category: Education
     
 

Presentation Description

No description available.

Comments

By: raj_123pbg (30 month(s) ago)

very good

Presentation Transcript

From DNATo RNATo Protein : 

From DNATo RNATo Protein Timothy G. Standish, Ph. D.

A Nucleotide : 

A Nucleotide ©1998 Timothy G. Standish

Two Families of Bases : 

Pyrimidines Purines ©1998 Timothy G. Standish Two Families of Bases

IntroductionThe Central Dogma of Molecular Biology : 

IntroductionThe Central Dogma of Molecular Biology Cell

Transcription And Translation In Prokaryotes : 

Transcription And Translation In Prokaryotes

Eukaryotic Transcription : 

Eukaryotic Transcription

Nucleotide Words : 

Nucleotide Words Words in the nucleotide language are all 3 letters or bases long. These three base “words” are called codons This means that there can only be 43 = 64 unique words.

A Codon : 

A Codon

Redundancy in the Code : 

Redundancy in the Code Codons code for only 20 words, or amino acids. In addition to the amino acids, the start and stop of a protein need to be coded for There are thus a total of 22 unique meanings for the 64 codons, so many codons are synonyms. The fact that many amino acids are coded for by several codons is called degeneracy

Why Not Use Shorter Codons? : 

Why Not Use Shorter Codons? If each codon was only 2 bases long, there would be 42 = 16 possible unique codons This would not provide enough unique meanings to code for the 22 things (20 amino acids plus start and stop) that have to be coded for.

The Genetic Code : 

S E C O N D B A S E A GGU GGC GGA GGG Gly* AGU AGC AGA AGG Arg G CGU CGC CGA CGG Arg G UGU UGC UGA UGG C GAU GAC GAA GAG AAU AAC AAA AAG Glu CAU CAC CAA CAG A UAU UAC UAA UAG Stop Tyr GUU GUC GUA GUG Val AUU AUC AUA AUG start Ile CUU CUC CUA CUG Leu U UUU UUC UUA UUG Leu Phe Met/ GCU GCC GCA GCG Ala ACU ACC ACA ACG Thr CCU CCC CCA CCG Pro C UCU UCC UCA UCG Ser U C A G U U C A G U C A G U C A G Gln† His Trp Cys T H I R D B A S E F I R S T B A S E The Genetic Code Asp Lys Asn† Stop Ser Neutral Non-polar Polar Basic Acidic †Have amine groups *Listed as non-polar by some texts

Initiation : 

Initiation The small ribosome subunit binds to the 5’ untranslated region of mRNA The small ribosomal subunit slides along the mRNA 5’ to 3’ until it finds a start codon (AUG) The initiator tRNA with methionine binds to the start codon The large ribosomal subunit binds with the initiator tRNA in the P site

How Codons Work:tRNA the Translators : 

How Codons Work:tRNA the Translators tRNA - Transfer RNA Relatively small RNA molecules that fold in a complex way to produce a 3 dimensional shape with a specific amino acid on one end and an anticodon on another part Associate a given amino acid with the codon on the mRNA that codes for it

Met-tRNA : 

Met-tRNA

Translation - Initiation : 

Translation - Initiation

Translation - Elongation : 

Translation - Elongation

Translation - Elongation : 

Aminoacyl tRNA Translation - Elongation

Protein Synthesis : 

Protein Synthesis

Translation - Elongation : 

Translation - Elongation

Translation - Elongation : 

Translation - Elongation

Translation - Elongation : 

Translation - Elongation

Problem 1 : 

Problem 1 Transcribe and translate the following DNA sequence: 3’AATAGTACCGCAAATTTATCGCTT5’ 5’UUAUCAUGGCGUUUAAAUAGCGAA3’ 5’UUAUC,AUG,GCG,UUU,AAA,UAG,CGAA3’ Met--Ala--Phe--Lys--Stop

The Genetic Code : 

S E C O N D B A S E A GGU GGC GGA GGG Gly* AGU AGC AGA AGG Arg G CGU CGC CGA CGG Arg G UGU UGC UGA UGG C GAU GAC GAA GAG AAU AAC AAA AAG Glu CAU CAC CAA CAG A UAU UAC UAA UAG Stop Tyr GUU GUC GUA GUG Val AUU AUC AUA AUG start Ile CUU CUC CUA CUG Leu U UUU UUC UUA UUG Leu Phe Met/ GCU GCC GCA GCG Ala ACU ACC ACA ACG Thr CCU CCC CCA CCG Pro C UCU UCC UCA UCG Ser U C A G U U C A G U C A G U C A G Gln† His Trp Cys T H I R D B A S E F I R S T B A S E The Genetic Code Asp Lys Asn† Stop Ser Neutral Non-polar Polar Basic Acidic †Have amine groups *Listed as non-polar by some texts