logging in or signing up pyramiding resistance genes for spot blotch and rusts through mas neerajvasistha8 Download Post to : URL : Related Presentations : Share Add to Flag Embed Email Send to Blogs and Networks Add to Channel Uploaded from authorPOINT lite Insert YouTube videos in PowerPont slides with aS Desktop Copy embed code: Embed: Flash iPad Copy Does not support media & animations WordPress Embed Customize Embed URL: Copy Thumbnail: Copy The presentation is successfully added In Your Favorites. Views: 211 Category: Education License: All Rights Reserved Like it (1) Dislike it (0) Added: June 26, 2011 This Presentation is Public Favorites: 0 Presentation Description Molecular Breediing in wheat Comments Posting comment... Premium member Presentation Transcript Pyramiding resistance genes for spot blotch and rusts through molecular marker selection in spring wheat (Triticum aestivum L em Thell). : Pyramiding resistance genes for spot blotch and rusts through molecular marker selection in spring wheat ( Triticum aestivum L em Thell). By Neeraj Kumar Vasistha Dept. of Genetics and Plant Breeding Institute of Agricultural Sciences BHU Varanasi Supervisor Co-Supervisor Prof. A.K.Joshi Dr. B. ArunWheat facts: Wheat facts Wheat is one of the major staple food crops of India and the world Wheat demand in India is growing continuously and the recent estimates suggest that it to be around 87.5 mt in 2020 (Chatrath et al. 2006, Joshi et al. 2007)Where from the yield increase will come?: Where from the yield increase will come? Since acreage expansion is not possible, increasing productivity through genetic manipulations shall be the primary hope Improved crop management would be the other option to sustain yield increase In both options, biotic stress management shall be very important Major biotic stresses of wheat: Major biotic stresses of wheat The three rusts, spread over whole of India. Yellow rust is mainly in North Western but brown rust is in all zones (Tomar et al., 2004) Black rust was not significant, but now has gained importance due to emergence of the Super Race - Ug99 (Ravi P. Singh, 2008) Spot blotch is very important in North East and in Peninsular zone (Chand et al., 2008)Some highlights of major biotic stresses of wheat: Some highlights of major biotic stresses of wheat The average yield loss due to leaf blight/spot blotch in S Asia is around 17% (Saari, 1998) All major cultivars of India (except HUW 234) and around of 80% of global wheat cultivars are susceptible to Ug99 (Dixon J et al., 2008) Possible solutions: Possible solutions Development of cultivars with improved resistance to biotic stresses combined with high productivity in a relatively short period of time using gene pyramiding with Marker Assisted Selection……….Advantages of Marker Assisted Selection are well known: Advantages of Marker Assisted Selection are well known Screening of trait that are extremely difficult phenotypically DNA markers permits marker aided selection for several character at one time Objectives: Objectives Pyramiding one or more of the genes/QTL for resistance to spot blotch to develop lines having enhanced resistance/near immunity Combining spot blotch resistance with durable rust resistance and agronomic performances using MASSlide 9: Major disease causing agents Disease Pathogens Spot blotch Bipolaris sorokiniana Stripe rust Puccinia striiformis f. sp. tritici. Leaf rust Puccinia triticina Stem rust Puccinia graminis f. sp. tritici Ug99 Puccinia graminis f. sp. tritici (TTKS)Knowledge about spot blotch: Knowledge about spot blotch Workers Year Findings Mohy 1914 Spot blotch was first reported . Dubin and Van Ginkel 1991 Important wheat disease in the warmer and humid part of world. Dubin et al. 1998 Its genetics is under polygenic control. Joshi et al. 2004 Only a few (3-4) additive genes control spot blotch resistance Uttam et al., 2008 Four QTLs found using SSRMarkers & locations of spot blotch resistance QTLs (Uttam et al., 2008).: Markers & locations of spot blotch resistance QTLs (Uttam et al., 2008). QTLs Markers Gene location QSB.BHU- 2A Xbarc353 2AL QSB.BHU- 2B Xgwm148 2B QSB.BHU- 5B Xgwm067 5B QSB.BHU-6D Xgwm148 6DKnowledge about rusts: Biffen 1905 Reported genetic basis of resistance Flor 1956 Gene for gene hypothesis Singh 1992 Reported genes behind durable, adult plant resistance to rusts McIntosh 1992 Reported possibility of at least 3 or 4 genes for APR to stripe rust Knowledge about rustsPossibility of maker aided selection: Possibility of maker aided selection Liu et al . 2004 Early generation selection with markers is the most efficient way of enriching the frequency of favourable alleles in segregating progenies Bonnett et al . 2005 Kuchel et al . 2005Markers & locations of rusts resistance genes: Markers & locations of rusts resistance genes Genes Marker Gene location References Yr9 XMla-LRR 1B/1R Mago et al. 2002 Yr26 Xgwm11 1B Jianxin et al. 2001 Lr34 Xgwm295 7D Suenaga et al. 2003 Sr2 gwm533 3B Speilmeyer et al. 2003: Sr24/Lr24 Sr24#50a 3D, 1B Mago et al. 2005a Sr22 gwm276 7A Jin et al., 2007 Sr26 Sr26#43 6A Knott 1961, 1968 Sr31 XMla-LRR 1B 1R Das et al., 2006 Sr36 Xwmc477 2B Bariana et al., 2001 Sr13 gwm617 6A Jin et al., 2007 Cont.Examples of gene pyramiding with MAS: Examples of gene pyramiding with MAS Crops Disease Reference Rice Bacterial leaf blight Yoshimura et al., 1995 Wheat Powdery mildew Liu et al., 2000 Wheat Fusarium head blight Anderson et al., 2001 Wheat Scab Zhou et al., 2003 Wheat Leaf rust Gupta et al.,2005 Wheat Leaf rust Gal et al., 2007Materials and Methods: Materials and MethodsTraits Targeted: Traits Targeted Low High Line Resistance & other traits Blight Lr Yr Sr Agro Qlty Donor + + + + + + Receipient - ± ± ± + + End product +++ +++ +++ +++ ++ +Genes/QTLs Targeted: Genes/QTLs Targeted Blight Lr Yr Sr QSb.bhu-2A Lr34 Yr18 Sr2 QSb.bhu-2B Lr46 Yr29 Sr22 QSb.bhu-5B Lr24 Sr24 QSb.bhu-6DSlide 20: *Popular under late sown conditions; HUW 234 = 2 m ha+ **Popular under timely sown conditionsPedigree of lines to be used: Pedigree of lines to be used Line Pedigree Yangmai 6 K 8101/K 68 HUWL 7-6 (WAXWING*2/KIRITATI) HUW 468 CPAN-1962/TONI//LIRA'S’/PRL'S' HUW 510 HD 2278/HUW 234//DL 230-16 HUW 234 HUW 12*2/CPAN 1666Trait Expression in Germplasm: Trait Expression in Germplasm Line Trait Expression Blight Lr Yr Sr Agro Yangmai6/Chirya + ± ± ± ± HUWL 6-4* ± + + + + HUWL 6-8* ± + + + + HUWL 7-5* ± + + + + HUWL 7-6* ± + + + + HUW 468 ± ± ± ± + HUW 510 - ± ± ± + HUW 234 - ± ± ± + *Resistant to Ug99 Low HighTarget End Product(s): Target End Product(s) Line Trait Expression Agro Blight Lr Yr Sr 1 n = >10 Low HighSlide 24: BC 3 F 2 s Yangmai 6 QTLs for blotch F 1 s BC 1 F 1 s BC 2 F 1 s X X X X BC 3 F 3 s Pyramiding QTLs for spot blotch Validation of Genes/QTL using MAS Replicated trial RP HUW 234 HUW 510 1st year (crop season) 1st year (off season ) 2nd year (crop season) 2nd year (off season) 3rd year (crop season) 3rd year (off season) 4th year (crop season) BC 3 F 4 s Multilocation evaluation 5th year (crop season) Foreground/background MAS BC 3 F 1 s Donor genotypes for resistance to spot blotch identified & used BC 3 F 2 s BC 3 F 3 s BC 3 F 4 s BC 3 F 2 s RP RPSlide 25: BC 3 F 2 s ( Waxwing*2/Kiritati) Lr34 , Lr46 ; Ug99 F 1 s BC 1 F 1 s BC 2 F 1 s X X X X BC 3 F 3 s Pyramiding genes for Lr, Yr & Ug99 Validation using MAS Replicated trial RP HUW 234 HUW 510 HUW 468 1st year (crop season) 1st year (off season ) 2nd year (crop season) 2nd year (off season) 3rd year (crop season) 3rd year (off season) 4th year (crop season) BC 3 F 4 s Multilocation evaluation 5th year (crop season) Foreground/background MAS BC 3 F 1 s Donor genotypes for resistance to leaf and Ug99 identified & used BC 3 F 2 s BC 3 F 3 s BC 3 F 4 s BC 3 F 2 s RP RPMethod for MAS: Method for MAS Leaf samples to be taken at seedling stage (within 1 month) DNA will be extracted and purified using CTAB method (Saghai - Maroof, 1984) Already developed MS primers will be used Validation/Identification of MS marker in parental lines and progenies to be done through gel electrophoresisMarkers to be used - SSR: Markers to be used - SSR Spot blotch QSb.bhu-2A, QSb.bhu-2B, QSb.bhu-5B & QSb.bhu-6D ( Uttam et al., 2008) Leaf rust Lr 34/Yr18 Marker: Xgwm295-7D 5‘ (Roder et al., 1998) GTGAAGCAGACCCACAACAC 3' 5' GACGGCTGCGACGTAGAG Primer pair used for csLV34 amplification (Lagudah et al., 2006) csLV34F: 5’GTTGGTTAAGACTGGTGATGG3’ CSlv34R: 5’TGCTTGCTATTGCTGAATAGT3’Markers to be used – SSR ….contd.: Markers to be used – SSR ….contd. Leaf rust Lr 46/Yr 29 SSR Xbarc80 - 1B 5' GCGAATTAGCATCTGCATCTGTTTGAG 3’ 5' CGGTCAACCAACTACTGCACAAC 3' SSR Xgwm259-1BLr46/Xwmc44-1B Stem rust Sr 2, Sr22, Sr24, Sr25, Sr1A1R Trials & statistical analysis: Trials & statistical analysis Data shall be recorded for Resistance to spot blotch and rusts Yield and yield traits (1000 wt., DM) Analysis of variance to be done & significantly superior lines to be identifiedOutcome expected: Outcome expected Elite lines with enhanced and stable expression of resistance to spot blotch and the rusts Superior agronomic lines with improved resistance (spot blotch and the rusts) (single or in combination)Slide 31: Thanks You do not have the permission to view this presentation. In order to view it, please contact the author of the presentation.
pyramiding resistance genes for spot blotch and rusts through mas neerajvasistha8 Download Post to : URL : Related Presentations : Share Add to Flag Embed Email Send to Blogs and Networks Add to Channel Uploaded from authorPOINT lite Insert YouTube videos in PowerPont slides with aS Desktop Copy embed code: Embed: Flash iPad Copy Does not support media & animations WordPress Embed Customize Embed URL: Copy Thumbnail: Copy The presentation is successfully added In Your Favorites. Views: 211 Category: Education License: All Rights Reserved Like it (1) Dislike it (0) Added: June 26, 2011 This Presentation is Public Favorites: 0 Presentation Description Molecular Breediing in wheat Comments Posting comment... Premium member Presentation Transcript Pyramiding resistance genes for spot blotch and rusts through molecular marker selection in spring wheat (Triticum aestivum L em Thell). : Pyramiding resistance genes for spot blotch and rusts through molecular marker selection in spring wheat ( Triticum aestivum L em Thell). By Neeraj Kumar Vasistha Dept. of Genetics and Plant Breeding Institute of Agricultural Sciences BHU Varanasi Supervisor Co-Supervisor Prof. A.K.Joshi Dr. B. ArunWheat facts: Wheat facts Wheat is one of the major staple food crops of India and the world Wheat demand in India is growing continuously and the recent estimates suggest that it to be around 87.5 mt in 2020 (Chatrath et al. 2006, Joshi et al. 2007)Where from the yield increase will come?: Where from the yield increase will come? Since acreage expansion is not possible, increasing productivity through genetic manipulations shall be the primary hope Improved crop management would be the other option to sustain yield increase In both options, biotic stress management shall be very important Major biotic stresses of wheat: Major biotic stresses of wheat The three rusts, spread over whole of India. Yellow rust is mainly in North Western but brown rust is in all zones (Tomar et al., 2004) Black rust was not significant, but now has gained importance due to emergence of the Super Race - Ug99 (Ravi P. Singh, 2008) Spot blotch is very important in North East and in Peninsular zone (Chand et al., 2008)Some highlights of major biotic stresses of wheat: Some highlights of major biotic stresses of wheat The average yield loss due to leaf blight/spot blotch in S Asia is around 17% (Saari, 1998) All major cultivars of India (except HUW 234) and around of 80% of global wheat cultivars are susceptible to Ug99 (Dixon J et al., 2008) Possible solutions: Possible solutions Development of cultivars with improved resistance to biotic stresses combined with high productivity in a relatively short period of time using gene pyramiding with Marker Assisted Selection……….Advantages of Marker Assisted Selection are well known: Advantages of Marker Assisted Selection are well known Screening of trait that are extremely difficult phenotypically DNA markers permits marker aided selection for several character at one time Objectives: Objectives Pyramiding one or more of the genes/QTL for resistance to spot blotch to develop lines having enhanced resistance/near immunity Combining spot blotch resistance with durable rust resistance and agronomic performances using MASSlide 9: Major disease causing agents Disease Pathogens Spot blotch Bipolaris sorokiniana Stripe rust Puccinia striiformis f. sp. tritici. Leaf rust Puccinia triticina Stem rust Puccinia graminis f. sp. tritici Ug99 Puccinia graminis f. sp. tritici (TTKS)Knowledge about spot blotch: Knowledge about spot blotch Workers Year Findings Mohy 1914 Spot blotch was first reported . Dubin and Van Ginkel 1991 Important wheat disease in the warmer and humid part of world. Dubin et al. 1998 Its genetics is under polygenic control. Joshi et al. 2004 Only a few (3-4) additive genes control spot blotch resistance Uttam et al., 2008 Four QTLs found using SSRMarkers & locations of spot blotch resistance QTLs (Uttam et al., 2008).: Markers & locations of spot blotch resistance QTLs (Uttam et al., 2008). QTLs Markers Gene location QSB.BHU- 2A Xbarc353 2AL QSB.BHU- 2B Xgwm148 2B QSB.BHU- 5B Xgwm067 5B QSB.BHU-6D Xgwm148 6DKnowledge about rusts: Biffen 1905 Reported genetic basis of resistance Flor 1956 Gene for gene hypothesis Singh 1992 Reported genes behind durable, adult plant resistance to rusts McIntosh 1992 Reported possibility of at least 3 or 4 genes for APR to stripe rust Knowledge about rustsPossibility of maker aided selection: Possibility of maker aided selection Liu et al . 2004 Early generation selection with markers is the most efficient way of enriching the frequency of favourable alleles in segregating progenies Bonnett et al . 2005 Kuchel et al . 2005Markers & locations of rusts resistance genes: Markers & locations of rusts resistance genes Genes Marker Gene location References Yr9 XMla-LRR 1B/1R Mago et al. 2002 Yr26 Xgwm11 1B Jianxin et al. 2001 Lr34 Xgwm295 7D Suenaga et al. 2003 Sr2 gwm533 3B Speilmeyer et al. 2003: Sr24/Lr24 Sr24#50a 3D, 1B Mago et al. 2005a Sr22 gwm276 7A Jin et al., 2007 Sr26 Sr26#43 6A Knott 1961, 1968 Sr31 XMla-LRR 1B 1R Das et al., 2006 Sr36 Xwmc477 2B Bariana et al., 2001 Sr13 gwm617 6A Jin et al., 2007 Cont.Examples of gene pyramiding with MAS: Examples of gene pyramiding with MAS Crops Disease Reference Rice Bacterial leaf blight Yoshimura et al., 1995 Wheat Powdery mildew Liu et al., 2000 Wheat Fusarium head blight Anderson et al., 2001 Wheat Scab Zhou et al., 2003 Wheat Leaf rust Gupta et al.,2005 Wheat Leaf rust Gal et al., 2007Materials and Methods: Materials and MethodsTraits Targeted: Traits Targeted Low High Line Resistance & other traits Blight Lr Yr Sr Agro Qlty Donor + + + + + + Receipient - ± ± ± + + End product +++ +++ +++ +++ ++ +Genes/QTLs Targeted: Genes/QTLs Targeted Blight Lr Yr Sr QSb.bhu-2A Lr34 Yr18 Sr2 QSb.bhu-2B Lr46 Yr29 Sr22 QSb.bhu-5B Lr24 Sr24 QSb.bhu-6DSlide 20: *Popular under late sown conditions; HUW 234 = 2 m ha+ **Popular under timely sown conditionsPedigree of lines to be used: Pedigree of lines to be used Line Pedigree Yangmai 6 K 8101/K 68 HUWL 7-6 (WAXWING*2/KIRITATI) HUW 468 CPAN-1962/TONI//LIRA'S’/PRL'S' HUW 510 HD 2278/HUW 234//DL 230-16 HUW 234 HUW 12*2/CPAN 1666Trait Expression in Germplasm: Trait Expression in Germplasm Line Trait Expression Blight Lr Yr Sr Agro Yangmai6/Chirya + ± ± ± ± HUWL 6-4* ± + + + + HUWL 6-8* ± + + + + HUWL 7-5* ± + + + + HUWL 7-6* ± + + + + HUW 468 ± ± ± ± + HUW 510 - ± ± ± + HUW 234 - ± ± ± + *Resistant to Ug99 Low HighTarget End Product(s): Target End Product(s) Line Trait Expression Agro Blight Lr Yr Sr 1 n = >10 Low HighSlide 24: BC 3 F 2 s Yangmai 6 QTLs for blotch F 1 s BC 1 F 1 s BC 2 F 1 s X X X X BC 3 F 3 s Pyramiding QTLs for spot blotch Validation of Genes/QTL using MAS Replicated trial RP HUW 234 HUW 510 1st year (crop season) 1st year (off season ) 2nd year (crop season) 2nd year (off season) 3rd year (crop season) 3rd year (off season) 4th year (crop season) BC 3 F 4 s Multilocation evaluation 5th year (crop season) Foreground/background MAS BC 3 F 1 s Donor genotypes for resistance to spot blotch identified & used BC 3 F 2 s BC 3 F 3 s BC 3 F 4 s BC 3 F 2 s RP RPSlide 25: BC 3 F 2 s ( Waxwing*2/Kiritati) Lr34 , Lr46 ; Ug99 F 1 s BC 1 F 1 s BC 2 F 1 s X X X X BC 3 F 3 s Pyramiding genes for Lr, Yr & Ug99 Validation using MAS Replicated trial RP HUW 234 HUW 510 HUW 468 1st year (crop season) 1st year (off season ) 2nd year (crop season) 2nd year (off season) 3rd year (crop season) 3rd year (off season) 4th year (crop season) BC 3 F 4 s Multilocation evaluation 5th year (crop season) Foreground/background MAS BC 3 F 1 s Donor genotypes for resistance to leaf and Ug99 identified & used BC 3 F 2 s BC 3 F 3 s BC 3 F 4 s BC 3 F 2 s RP RPMethod for MAS: Method for MAS Leaf samples to be taken at seedling stage (within 1 month) DNA will be extracted and purified using CTAB method (Saghai - Maroof, 1984) Already developed MS primers will be used Validation/Identification of MS marker in parental lines and progenies to be done through gel electrophoresisMarkers to be used - SSR: Markers to be used - SSR Spot blotch QSb.bhu-2A, QSb.bhu-2B, QSb.bhu-5B & QSb.bhu-6D ( Uttam et al., 2008) Leaf rust Lr 34/Yr18 Marker: Xgwm295-7D 5‘ (Roder et al., 1998) GTGAAGCAGACCCACAACAC 3' 5' GACGGCTGCGACGTAGAG Primer pair used for csLV34 amplification (Lagudah et al., 2006) csLV34F: 5’GTTGGTTAAGACTGGTGATGG3’ CSlv34R: 5’TGCTTGCTATTGCTGAATAGT3’Markers to be used – SSR ….contd.: Markers to be used – SSR ….contd. Leaf rust Lr 46/Yr 29 SSR Xbarc80 - 1B 5' GCGAATTAGCATCTGCATCTGTTTGAG 3’ 5' CGGTCAACCAACTACTGCACAAC 3' SSR Xgwm259-1BLr46/Xwmc44-1B Stem rust Sr 2, Sr22, Sr24, Sr25, Sr1A1R Trials & statistical analysis: Trials & statistical analysis Data shall be recorded for Resistance to spot blotch and rusts Yield and yield traits (1000 wt., DM) Analysis of variance to be done & significantly superior lines to be identifiedOutcome expected: Outcome expected Elite lines with enhanced and stable expression of resistance to spot blotch and the rusts Superior agronomic lines with improved resistance (spot blotch and the rusts) (single or in combination)Slide 31: Thanks