Category: Entertainment

Presentation Description

No description available.


By: elizabeth330828 (9 month(s) ago)

esta informacion la necesito

By: elizabeth330828 (9 month(s) ago)

esta informacion la necesito

Presentation Transcript

La información genética:

La información genética

1. Ácidos nucleicos. ´ - Composición. - Tipos. 2. La replicación ADN. 3. ADN portador información genética ( experimentos). 4. Concepto de gen. 5. Mutaciones. Tipos. 6.Expresión de la información genética. 7. Aplicaciones: - Biotecnología. -Ingeniería genética. - Alimentos transgénicos. - Clonación. :

1. Ácidos nucleicos. ´ - Composición. - Tipos. 2. La replicación ADN. 3. ADN portador información genética ( experimentos). 4. Concepto de gen. 5. Mutaciones. Tipos. 6.Expresión de la información genética. 7. Aplicaciones: - Biotecnología. -Ingeniería genética. - Alimentos transgénicos. - Clonación.

Video :


PowerPoint Presentation:

INICIO ESQUEMA RECURSOS INTERNET Lectura inicial Una mañana de marzo, dos jóvenes científicos, el físico Francis Crick y el biólogo James Watson anunciaron que habían conseguido revelar la estructura del ADN. Este descubrimiento, que revolucionó el mundo de la biología, fue anunciado en 1953, pero había empezado unos años antes. En 1951 Watson, se instaló en Cambridge para compartir con Crick, la aventura de determinar la estructura del ADN. En este momento, la única tecnología disponible para visualizar la estructura de grandes moléculas era la difracción de rayos X, que consistía en algo parecido a radiografiar una molécula. Paralelamente, la fisicoquímica Rosalind Franklin y el biofísico Maurice Wilkins realizaban estudios cristalográficos de difracción de rayos X sobre moléculas de ADN. En 1952 Rosalind Franklin obtuvo una fotografía de difracción por rayos X que reveló la estructura helicoidal de la molécula de ADN. Wilkins, sin el consentimiento de Franklin, hizo llegar la fotografía a Watson y Crick. Esa imagen constituyó uno de los datos definitivos que les llevó a pensar que la estructura del ADN estaba formada por una doble hélice, y no triple como se pensaba. Rosalind Franklin murió en 1958, a los 37 años de edad, víctima de un cáncer. Cuatro años después, Watson, Crick y Wilkins recibieron el Premio Nobel de Medicina y Fisiología por sus aportaciones al descubrimiento de la estructura del ADN. La inestimable aportación de R. Franklin a este descubrimiento no fue reconocida ni en vida ni de manera póstuma, aunque poco a poco la historia comienza a reconocer su labor. SALIR ANTERIOR Rosalind Franklin Molecula de ADN Watson y Crick

PowerPoint Presentation:

En qué lugar de las células eucariotas se encuentra el ADN? ¿ Y de las procariotas?. ¿Qué son los genes? ¿Dónde se localizan? ¿Cómo se hereda la información genética? ¿Qué es una proteína?¿Cómo se llaman las unidades que la constituyen? ¿Qué significa clonar?

Los ácidos nucleicos:

Los ácidos nucleicos FUNCIÓN. Almacenan y trasmiten la información genética


ÁCIDOS NUCLEICOS Son polímeros de nucleótidos


nucleótidos Están formados por tres piezas Fosfato Pentosa Ribosa ARN Dexosirribosa ADN Base nitogenada A ADENINA GRANDES G GUANINA PEQUEÑOS C CITOSINA T TIMINA U URACILO Son cíclicas y tienen N

Ácidos nucleicos: Composición: Nucleótidos :

Ácidos nucleicos: Composición: Nucleótidos

Ácidos nucleicos:

Ácidos nucleicos Los nucleótidos se unen entre sí formando largas cadenas: ÁCIDOS NUCLEICOS El fosfato de un nucleótido se une a la pentosa de otra por un enlace.

Unión entre nucleótidos:

Unión entre nucleótidos

Ácido nucleico:

nucle ó tido En cada ácido nucleico, hay : Una parte invariable ( fosfato pentosa ). Una parte variable: las bases nitrogenadas. Ácido nucleico

PowerPoint Presentation:

. TATTTACCCCGCTTAATGCCCCCC CCCCCGTAATTCGCCCCATTTAT El orden de las bases de los ácidos nucleicos determina la información de cómo fabricar las proteínas de nuestro cuerpo. 1 2 3 4

Tipos de ácidos nucleicos.:

Tipos de ácidos nucleicos. ARN ADN Ácido ribonucleico Ácido desoxirribonucleico


TIPOS DE ÁCIDOS NUCLEICOS Hay dos tipos de ácidos nucleicos: - ADN (ácido desoxirribonucleico) - ARN (ácido ribonucleico)

Comparativa ADN/ARN:

Comparativa ADN/ARN ADN ARN Composición Desoxirribosa A, T , G, C Ribosa A, U , G, C Localización Eucariota: Núcleo. Mitocondrias y Cloroplastos. Núcleo Citoplasma. Ribosomas . Estructura Dos cadenas unidas ( doble hélice ) Una cadena simple. Función. Lleva información genética. Arquitecto Ayuda a que se exprese el ADN Perito, albañil

PowerPoint Presentation:

Hacer ejercicios 1 y 3 pag 18 . 4, 5 y 6 de página 29.


ADN ÁCIDO DESOXIRRIBONUCLEICO FUNCIÓN: Lleva la información genética necesaria para el funcionamiento de un ser vivo. LOCALIZACIÓN Se encuentra en: Núcleo -Cromosomas. -Cromatina. Mitocondrias Cloroplastos

Descubrimiento de la estructura adn:

Descubrimiento de la estructura adn Fue descubierta por: James Watson Francis Crick Con los datos de Maurice Wilkins Rosalind Franklin Recibieron Premio Nobel en 1962

PowerPoint Presentation:


Estructura del ADN:

Estructura del ADN Son dos cadenas de nucleótidos enrolladas en espiral alrededor de un eje. Forma una DOBLE HÉLICE.

Estructura adn:

Estructura adn Fosfato Pentosa Pares de bases Las pentosas y los fosfatos están al exterior Las bases nitrogenadas se encuentran hacia el interior. Las dos cadenas son antiparalelas ( siguen sentidos opuestos)

Estructura del ADN:

Estructura del ADN Las cadenas se unen por puentes de hidrógeno entre las bases nitrogenadas de ambas. Las cadenas son complementarias A se une siempre a T G se une siempre a C A T G C

Estructura del adn:

Estructura del adn Es como una escalera de caracol Las barandas al exterior son los fosfatos-pentosas Los peldaños, al interior, son los pares de bases nitrogenadas.

Estructura del ADN:

Estructura del ADN La secuencia de bases de una cadena determina la de la otra.

PowerPoint Presentation:

Dos pirimidinas unidas, son demasiado pequeñas para el diámetro del ADN. Dos purinas unidas, son demasiado grandes para el diámetro del ADN. Una pirimidina unida a una purina tienen el tamaño del diámetro del ADN.

PowerPoint Presentation:

Un par A-T, tenía igual forma que una C-G

PowerPoint Presentation:

Clase: 1, 2, 3 , 4 y 6

PowerPoint Presentation:

INICIO ESQUEMA RECURSOS INTERNET Estructura del ADN SALIR ANTERIOR Doble hélice Cadenas antiparalelas Puentes de hidrogeno Polinucleótidos Si una cadena del ADN es: A T G C A T G C A T G C ¿Cuál será la de la otra? T A C G T A C G T A C G

PowerPoint Presentation:

INICIO ESQUEMA RECURSOS INTERNET Estructura del ADN SALIR ANTERIOR Doble hélice Cadenas antiparalelas Puentes de hidrogeno Polinucleótidos Si una molécula de ADN tiene 18% de A ¿Cuánto tendrá de las otras bases? A= 18% A=T, T= 18%. A+T=36% G+C=100-36%= 64% G=C, G= 32%, C=32%.

PowerPoint Presentation:

fosfato desoxirribosa T C T A C g NUCLEÓTIDO

PowerPoint Presentation:



arn FUNCIÓN : Ayuda al ADN en la fabricación de proteínas. COMPOSICIÓN : Tiene RIBOSA como azúcar. Tiene: G,C,A y Uracilo (Nunca timina) ESTRUCTURA : Una sola cadena de nucleótidos. LOCALIZACIÓN : Núcleo, citoplasma, ribosomas.


TIPOS DE ARN ARN mensajero ARN transferente ARN ribosómico

PowerPoint Presentation:

ADN ARNm Ribosoma Aminoácidos ARN t Aa Código genético ARNr Proteínas

Tipos de ARN:

Tipos de ARN

PowerPoint Presentation:

Copia información del ADN y la transporta hasta los ribosomas “Perito” ARN mensajero INICIO ESQUEMA RECURSOS INTERNET Tipos de ARN SALIR ANTERIOR Se asocia a proteínas y forma los ribosomas. Ayuda a unir los Aa para formar proteínas. Es el “albañil”. ARN ribosomico Se une a aminoácidos y los transporta hasta el ribosoma para formar proteínas . Y los pone según el orden que dicta el ARNm Es “el peón”. ARN transferente ARNm ARNr ARNt


Ejercicios 46, 47,48 y 51de pág 44



La replicación ADN:

Burbuja de replicación ADN ¿ Para qué? ¿En qué fase del ciclo celular se produce? La replicación ADN El ADN tiene la capacidad de duplicarse y hacer copias exactas de sí mismo.

Replicación adn:

Replicación adn Interfase (Fase S) Se duplican el ADN, se duplican las cromátidas. La replicación del ADN permite que las células hijas resultantes de la mitosis tengan la misma información genética que la célula madre. La duplicación se produce en el periodo S de la interfase .

Proceso replicación:


Proceso replicación:

1º Se rompen los enlaces entre las bases. Las dos hebras se separan. Proceso replicación

Proceso replicación:

2º Cada cadena antigua sirve como molde para una nueva. Se colocan nucleótidos de forma complementaria. Proceso replicación

Proceso replicación:

Resultado: Dos cadenas de ADN iguales entre sí e iguales a la original Proceso replicación

PowerPoint Presentation:

Se forman nuevos enlaces de hidrogeno y las hebras se enrollan Síntesis de nuevas cadenas complementarias Rotura de enlaces de hidrogeno La replicación del ADN INICIO ESQUEMA RECURSOS INTERNET SALIR ANTERIOR Burbuja de replicación ADN VOLVER

Replicación adn:

Replicación adn La replicación es SEMICONSERVATIVA Las nuevas copias conservan una de la cadena original y una cadena nueva.

replicación del adn:

replicación del adn Las dos cadenas de ADN fabricadas en la replicación son las dos cromátidas del cromosoma.

Errores en la replicación: mutaciones:

Errores en la replicación: mutaciones Durante la replicación pueden ocurrir errores, lo que da lugar a copias imperfectas de ADN. Estos errores dan lugar a MUTACIONES .


Ejercicios 7 y 8 de pág 30 51 de pág 41

Adn portador de la herencia:

Adn portador de la herencia ¿ADN o proteínas? Los cromosomas están constituidos por ADN y proteínas , en cantidades parecidas.

Adn, portador herencia:

Adn , portador herencia En principio se pensó que eran las proteínas las que llevaban la información genética porque el ADN tenía una composición más sencilla.

Experimento grifith:

Experimento grifith Vídeo

Experimento de grifith.:

Experimento de grifith.

Experimento griffith:

Experimento griffith Trabajó con dos cepas de la bacteria que causa la neumonía. Cepa S Bacterias con cápsula. Producían la enfermedad y la muerte del ratón. on Cepa R Bacterias sin cápsula. No producían la enfermedad ni muerte del ratón.

Experimento de griffith:

Experimento de griffith Cuando inyectaba bacterias S con cápsula a los ratones Los ratones morían Cuando inyectaba bacterias R sin cápsula a los ratones Los ratones vivían Cuando inyectaba bacterias S muertas con calor Los ratones vivían

Experimento griffith:

Experimento griffith Cuando inyectó una mezcla Bacterias S (patógenas) muertas por calor Bacterias R (no patógenas) Los ratones morían ¿Porqué?. Que pasa a las bacterias R y las transforma en S (patógenas) En las bacterias S muertas hay “un principio transformante”

Experimento avery:

Experimento avery Avery demostró en 1944 que el “principio transformante” era el ADN El ADN es la molécula que lleva la información genética

PowerPoint Presentation:

Bacterias muertas de la cepa S y bacterias de la cepa R Provocan la muerte Bacterias muertas de la cepa S de Streptococcus pneumoniae Son inofensivas Bacterias de la Cepa R de Streptococcus pneumoniae No son virulentas Bacterias de la cepa S de Streptococcus pneumoniae Provocan la muerte del ratón El ADN como portador de información genética. Experimento de Griffith INICIO ESQUEMA RECURSOS INTERNET SALIR ANTERIOR VOLVER 1 2 3 4

Concepto de gen:

Concepto de gen Un gen es un trozo de ADN que lleva la información para que se fabrique una proteína, necesaria para que se exprese un carácter (color de ojos,de pelo..)

Concepto de gen:

Concepto de gen

Concepto de gen:

Concepto de gen Cada gen tiene una secuencia de nucleótidos determinada y se localiza en un lugar concreto del cromosoma.


genoma No todo el ADN codifica para proteínas Solo el 1% del ADN lleva información genética El 90% restante No lleva información Sirve para regular la expresión de otros genes


genoma Es el conjunto de genes de un organismo.

Estructura del genoma:

Estructura del genoma Es diferente en procariotas y eucariotas * PROCARIOTAS Un solo cromosoma circular. Poseen plásmidos : moléculas de ADN circular que se replican de forma independiente * EUCARIOTAS Tiene varias moléculas de ADN lineal, que forman los cromosomas ( en humanos 46 moléculas). También hay ADN en cloroplastos y mitocondrias.

PowerPoint Presentation:

Organismos procariotas Organismos eucariotas INICIO ESQUEMA RECURSOS INTERNET La estructura del genoma SALIR ANTERIOR Secuencia especifica de nucleótidos (gen) Cromosoma Cromatina Plásmido


Ejercicios 12 de pág 32



PowerPoint Presentation:

¿Por qué somos diferentes?


mutaciones ¿Son buenas o malas?


mutaciones * MUTACIONES Son cambios que se producen en el ADN de un individuo. * Son fuente de variabilidad * Necesarias para la evolución.

Causas de las mutaciones:

Causas de las mutaciones * Espontáneas Por errores en la duplicación del ADN * Inducidas Causadas por AGENTE MUTAGÉNICOS ( aumentan la frecuencia de mutación ) * Físicos Radiactividad Rayos UV Químicos Humo tabaco, Fármacos Colorantes Aditivos alimentarios

PowerPoint Presentation:

INICIO ESQUEMA RECURSOS INTERNET Los tipos de mutaciones SALIR ANTERIOR Según el efecto sobre el individuo Según la extensión del material genético afectado Según el tipo de células afectadas

Mutaciones según el efecto en el individuo:

Mutaciones según el efecto en el individuo * PERJUDICIALES Confieren desventaja para la supervivencia. BENEFICIOSAS Aumentan la supervivencia. Aumentan la variabilidad. NEUTRAS No afectan a la supervivencia

tipos según su efecto:

tipos según su efecto EFECTOS NEGATIVOS (Incluso llegan a ser letales) C áncer EFECTOS POSITIVOS Aumentan la variabilidad en las poblaciones y permiten la evolución NEUTRAS No tienen influencia negativa ni positiva en el individuo o la especie.

Según el tipo de células afectadas:

Según el tipo de células afectadas SOMÁTICAS Afectan a células somáticas. No se heredan Pueden provocar lesiones graves: CÁNCER GERMINALES Afectan a LOS GAMETOS No se manifiestan en el individuo Se heredan. Aparecen en la descendecia .

Segú extensión del material genético afectado:

Segú extensión del material genético afectado GÉNICAS Cambia la secuencia de nucleótidos. Ejm : albinismo o anemia falciforme. GENÓMICAS Variación nº de cromosomas Ej : Síndrome Down. CROMOSÓMICA Cambia la estructura de un cromosoma. Ejm : Síndrome grito del gato

Síndrome Down:

Síndrome Down 46+c21 Retraso mental Rasgos faciales Cara redonda Ojos oblicuos Dos líneas en la mano Lesiones cardiovasculares Tendencia a la leucemia Infertilidad en hombres

PowerPoint Presentation:

Aumento del número de pulsaciones y de la longitud de las fibras cardíacas, lo que conlleva riesgo de insuficiencia cardíaca . Mareos frecuentes. Disminución del número de hematíes, debido a su extrema fragilidad. Anoxia de tejidos, provocada por el esfuerzo. Obstrucción y desgarro de venas . Disminución de hemoglobina. En niños es mas común la Dactilitis Crisis vaso-oclusivas

Síndrome de Turner (45, X):

Síndrome de Turner (45, X) 1/2.000 nacidas vivas

Síndrome Turner:

Síndrome Turner 44+X Baja estatura Codo deformado No desarrollo sexual Pliegues en cuello Estenosis de la aorta.



Síndrome edwars Trisomía18:

Síndrome edwars Trisomía18 46+c18 Pequeños al nacer Crecen lentamente Retraso mental Cabeza alargada Cuello ancho Orejas faunescas Mentón deprimido Deformación caderas Dedos montados

Síndrome klinefelter XXY:

Síndrome klinefelter XXY 44+XXY Pecho desarrollado Caderas anchas Poco desarrollo vello corporal Genitales pequeños Retraso mental

Síndrome del grito del gato:

Síndrome del grito del gato Las principales características son: microcefalia, raíz nasal plana, paladar hendido, orejas bajas. Los rasgos comunes a todos los casos son: la peculiar forma de la cara, y el llanto característico de la primera infancia.


ejercicios 16,17 y 18 pág 33.

La expresión de la información genética:

La expresión de la información genética proteína aminoácidos Las proteínas están formadas por piezas: A minoácidos . Hay 20 Aa diferentes Cada proteína tiene un número y un orden diferente de Aa .

La expresión de la información genética:

La expresión de la información genética G G G A A A T T C TRIPLETE 1 TRIPLETE 2 TRIPLETE 3 El ADN lleva la información para fabricar las proteínas en el orden de los nucleótidos La información se lee en grupos de tres nucleótidos: TRIPLETES

Expresión génica:

Expresión génica ADN El ADN necesita la ayuda del ARN para fabricar las proteínas ARN PROTEÍNAS


EXPRESIÓN GÉNICA La expresión de los genes para formar proteínas tiene que ser descodificada Tiene lugar en dos fases: TRANSCRIPCIÓN ADN Fabricación de ARN a partir de ADN ARN TRADUCCIÓN Fabricación de proteínas con la información del ARN proteínas


Entonces ... DOGMA ACTUALIZADO 02/12/2014 15:24 115


transcripción Consiste en copiar la información de un gen de ADN para fabricar una molécula de ARNm ADN ARN T A A G C C G T C A U U C G G C A G Tiene lugar en el núcleo.


transcripción La doble hélice de ADN se abre y una de sus cadenas se copia (un gen) para sintetizar una molécula de ARNm ARNm =perito El ARNm se copia de forma complementaria ADN A ARN U T A G C C G La base complementaria a la A en el ARN es el U, no la T.



PowerPoint Presentation:



traducción Es el proceso por el que se traduce el mensaje del ARNm al lenguaje de las proteínas Tiene lugar en los ribosomas del citoplasma Los ribosomas leen la información el ARNm en grupos de tres nucleotidos que se denominan CODONES. ARN Cada codón se traduce, siguiendo el CÓDIGO GENÉTICO en un AMINOÁCIDO


TRADUCCIÓN En la traducción se necesitan tres tipos de ARN ARNm (perito) Lleva una copia de la información del ADN al citoplasma ARNt (peón) Acarrea los Aa del citoplasma al ribosoma y los coloca según el orden de los codones del ARNm ARNr (albañil) Interviene en la unión de los Aa para formar proteínas


traducción Cada ARNt lleva un Aa concreto según un triplete de nucleótidos en su molécula denominado ANTICODON. Cada ANTICODON es complementario a un CODON del ARNm . De esta forma los aminoácidos se colocan según el orden de los codones del ARNm


SALIR ANTERIOR ARNm ARNr ARNt Proteínas Síntesis de proteínas traducción A continuación, el ARNr interviene en la unión de los Aa para formar las proteínas.

PowerPoint Presentation:


PowerPoint Presentation:

ADN ARNm Ribosoma Aminoácidos ARN t Aa Código genético ARNr Proteínas TRADUCCIÓN CODÓN Anticodon Traducción

Código genético:

Código genético


EL CÓDIGO GENÉTICO Nucleótidos aminoácidos Es el diccionario que traduce: el lenguaje de los nucleótidos del ARNm . al lenguaje de los aminoácidos de la proteína. .


CARACTERÍSTICAS DEL CÓDIGO GENÉTICO Es universal : es el mismo para todos los seres vivos. Hay 64 codones para 20 Aa ¿Cuántos codones codifican para un Aa ? Hay varios codones para un Aa. Ej : Ala GCU GCC GCA GCG ¿Hay algún triplete que no codifique para ningún Aa ? Hay codones que no codifican para ningún Aa , se entienden como parada de la traducción e indica que la proteína a terminado. UGA UAA UAG INICIO El codon UAG indica el comienzo de la proteína

Código genético:

Código genético 64 tripletes 20 Aa 61 tripletes codifican Aa 1 Aa = varios tripletes 3 tripletes stop_ UAA UAG UGA

PowerPoint Presentation:

5’GUA3’ Valina 3’CAT5’ 3’ACT5’ 3’ACU5’ Stop 5’AAG3’ 5’AAA3’ 3’TTC5’ 3’TTT5’ 3’UUC5’ 3’UUU5’ 5’AUG3’ 3’UAC5’ Inicio/ Metionina 3’TGC5’ 3’UGC5’ Treonina


ejercicios 19,20, 21 y 22 52,54 y 55

authorStream Live Help