02 2010

Views:
 
Category: Entertainment
     
 

Presentation Description

cereales

Comments

Presentation Transcript

slide 1:

Journal of Cereal Science Aims and Scope The Journal of Cereal Science was established in 1983 to provide an international forum for the publication of original research papers of high standing covering all aspects of cereal science related to the functional and nutritional quality of cereal grains and their products. The journal also publishes concise and critical review articles appraising the status and future directions of specific areas of cereal science and short rapid communications that present news of important advances in research. The journal aims at topicality and at providing comprehensive coverage of progress in the field. Research areas include: Composition and analysis of cereal grains in relation to quality in end use Morphology biochemistry and biophysics of cereal grains relevant to functional and nutritional characteristics Structure and physicochemical properties of functionally and nutritionally important components of cereal grains such as polysaccharides proteins oils enzymes vitamins and minerals Storage of cereal grains and derivatives and effects on nutritional and functional quality Genetics agronomy and pathology of cereal crops if there is a substantive relationship to end-use properties of cereal grai ns Functional and nutritional aspects of cereal-based foods and beverages whether baked fermented or extruded Industrial products e.g. starch derivatives syrups protein concentrates and isolates from cereal grains and their techn ology G. B. Fincher Waite Agricultural Research Institute University of Adelaide Australia R. A. Graybosch USDA-ARS University of Nebraska Lincoln Nebraska USA R. J. Hamer Wageningen Centre for Food Sciences Wageningen The Netherlands D. Lafiandra Dipartimento di Agrobiologia e Agrochimica University of Tuscia Viterbo Italy J. R. N. Taylor University of Pretoria South Africa S. Bean USDA-ARS GMPRC Manhatten USA A. Blechl US Department of Agriculture USDA Albany CA USA P. Colonna INRA Laboratoire de Biochimie et Technologies des Glucides Nantes France K. Denyer John Innes Centre Norwich UK J. Dexter Canadian Grain Commission Winnipeg Manitoba Canada R. DOvidio Universita degli Studi della Tuscia Viterbo Italy P. J. Frazier Dalgety Food Technology Centre Cambridge UK Zhonghu He International Maize and Wheat Improvement Center Chinese Academy of Agricultural Sciences Beijing China B. O. Juliano Philippines Rice Research Institute Laguna Philippines P. Koehler German Research Centre for Food Chemistry Garching Germany J. Kokini Cook College Rutgers University New Brunswick New Jersey USA O. R. Larroque CSIRO Plant Industry Canberra Australia A. W . MacGregor Livingston Scotland UK M.-H. Morel iNRA Joint Research Unit "Agropolymers Engineering and Emerging Technologies" Montpellier France K. Poutanen VTT Biotechnology Espoo Finland C. M. Rosell Food Science Department IATA-CSIC Valencia Spain S. O. Serna Saldivar ITESM Monterrey Mexico B. Svensson BioCentrum-DTU The Technical University of Denmark Kgs. Lyngby Denmark Editor-in-Chief F. MacRitchie Grain Science and Industry Department Kansas State University Manhattan Kansas USA Editors Reviews Editor P. R. Shewry Rothamsted Research Harpenden UK Editorial Board T. Galliard and J. D. Schofield Author enquiries For enquiries relating to the submission of articles including electronic submission where available please visit this journal’s homepage at http://www.elsevier.com/locate/jcs. You can track accepted articles at http://www.elsevier.com/trackarticle and set up e-mail alerts to inform you of when an article’s status has changed. Also accessible from here is information on copyright frequently asked questions and more. Contact details for questions arising after acceptance of an article especially those relating to proofs will be provided by the publisher. Founding Editors For a full and complete Guide for Authors please go to: http://www.elsevier.com/wps/find/journaldescription.cws_home/622859/authorinstructions

slide 2:

Effects of the replacement of Glu-A1 by Glu-D1 locus on agronomic performance and bread-making quality of the hexaploid wheat cv. Courtot J. Dumur ab J. Jahier a M. Dardevet b H. Chiron c A.-M. Tanguy a G. Branlard b a INRA UMR-Agrocampus Rennes Ame ´lioration des Plantes et Biotechnologies Ve ´ge ´tales BP 35327 35653 Le Rheu France b INRA UMR 1095-UBP Ge ´ne ´tique Diversite ´ et Ecophysiologie des Ce ´re ´ales GDEC 234 Avenue du Bre ´zet 63100 Clermont-Ferrand France c INRA BIA – MC2 Rue de la Ge ´raudie `re. BP 71 627 44 316 Nantes Cedex 03 France article info Article history: Received 28 August 2009 Received in revised form 27 October 2009 Accepted 4 November 2009 Keywords: Bread wheat Bread-making quality HMW glutenin subunit Glu-D1 duplication abstract TheaimofthisstudywastoevaluatethecumulativeandinteractiveeffectsonwheatTriticumaestivumL. gluten strength and mixing properties of dough associated with the duplication of the Glu-D1 locus. ApartiallyisohomoeoalleliclineRR240inwhichasegmentofthewheatchromosome1Dcontainingthe Glu-D1 locus encoding the Dx2þDy12 subunits and translocated tothe long arm of the chromosome 1A throughhomoeologousrecombinationwasassessed.Agronomictraitsandyieldcomponentswerestudied in the translocated line RR240and comparedwith the control line cv.Courtot. Bothlines were evaluated under field conditions in two experimental years. Technological effects resulting from the duplication of HMWgluteninsubunitsDx2andDy12wereevaluatedusingtheAlveographtesttheMixographtestand thebakingtest.TheRR240linewasshowntohavealoweragronomicperformancefor1000-kernelweight and grain yield. However the duplication of the Glu-D1 allele was associated with a significant effect on doughstrengthandmixingresistanceandontheZelenysedimentationvolume.Bakingparameterswere notsignificantlymodifiedbetweenbothlinesalthoughthescorevaluesoftheCNERNAtestwereobserved tobeslightlyhigherinRR240thaninCourtot. 2009 Elsevier Ltd. All rights reserved. 1. Introduction Seed storageproteinshave beensubjected to numerous studies because of their importance in bread-making quality of Triticum aestivum L. see for review Wrigley et al. 2006. Both the quantity and the diversity of the gluten proteins gliadins and glutenins which are controlled byclustersof geneslocated on chromosomes of homoeologous groups 1 and 6 influence the dough quality. Allelic variation in composition of high molecular weight glutenin subunits HMW-GS encoded by Glu-1 loci is associated with large differences in the bread-making properties in particular in the glutenin aggregation and gluten rheological behavior Branlard etal.19922001. Selectionindicesforqualityevaluation inwheat breeding have been established for each HMW-GS in the additive context of co-dominant Glu-1 genes. Several alleles including Glu- D1d allele Dx5þDy10 were associated with good bread-making quality and dough strength. Many researchers have shown that storage protein genes controlled by the 1D chromosome have a major impact on quality Bittel et al. 1991 Rogers et al. 1990 Welsh and Hehn1964 a dramatic reduction of dough rheological properties being observed in null genotypes at the Glu-D1 locus Lawrenceetal.1988.Thisobservationisinagreementwithother onesindicatingthattheGlu-D1locusaccountsforthelargestpartof the total HMW-GS amount in gluten Wieser and Zimmermann 2000. Whereas the duplication of Glu-D1 genes carried by the long arm of 1D could be beneficial for bread wheat quality transfer of the Glu-D1 locus from chromosome 1D to 1A has been only exploited as a means to improve baking quality of durum wheat and triticale. That goal has not been achieved in bread wheat. Lukaszewskiand Curtis19921994 had translocatedin hexaploid triticale a chromosomal segment of the wheat 1DL containing the Glu-D1dallele encoding the HMW-GS Dx5þDy10 tothe longarm ofthechromosome1Randtothelongarmofthechromosome1A. The translocated wheat chromosome was then transferred to durumwheat Blanco et al. 2002. The effect on grain quality was measuredbySDS-sedimentationvaluebutnorheologicaldatawas obtained. Vitellozzi et al. 1997 reported the transfer of a chro- mosomalsegmentof the1DLcontainingGlu-D1dalleleintothe1A chromosome long arm of tetraploid wheat. But here again no technological data were reported regarding the effects of the translocation on agronomic and quality traits. Klindworth et al. Corresponding author. Tel.:þ33 0 4 73 62 43 16 fax:þ33 0 4 73 62 44 53. E-mail address: branlardclermont.inra.fr G. Branlard. Contents lists available at ScienceDirect Journal of Cereal Science journal homepage: www.elsevier.com/locate/jcs 0733-5210/ – see front matter 2009 Elsevier Ltd. All rights reserved. doi:10.1016/j.jcs.2009.11.009 Journal of Cereal Science 51 2010 175–181

slide 3:

2005 have tested durum wheat lines obtained by Joppa et al. 1998 carrying Glu-D1d on a 1AS.1AL-1DL translocated chromo- some and segregating for the low molecular weight glutenin subunits LMW-GS. Flour of these lines had excessively strong mixing characteristics but did not exhibit improved loaf volume compared to the control cultivar Renville. Both decreased tillering and kernel weight were associated with lower yield of most translocated lines. To increase the copy number of Glu-1 loci the use of homoe- ologous recombination between wheat homoeologues was the dedicated approach used by our group to create isohomoeoallelic lines for HMW-GS. These bread wheat lines when produced should carry the same Glu-1 gene on each homoeologous group 1 chromosome. An intermediate stage in their development is the extraction of partially isohomoeoallelic genotypes in which one Glu-1geneiscarriedbytwogroup1chromosomes.Thepurposeof this study was to investigate agronomic traits and bread-making quality of both the parental hexaploid cv Courtot and its near isogenic line RR240 where the Glu-A1 locus was replaced by a chromosome segment from 1DL consequently making the line with two sets of the Glu-D1a allele encoding Dx2þDy12 subunits. 2. Experimental 2.1. Plant material Experiments have been performed with the cultivar Courtot which is a French semi-dwarf winter bread wheat of good bread- making quality. Courtot has the HMW glutenin profile Ax2 Bx7þBy8 and Dx2þDy12 corresponding to the alleles Glu-A1b Glu-B1b and Glu-D1a respectively. To improve the bread-making quality of hexaploid wheat by elaborating novel HMW-GS combi- nations a partially isohomoeoallelic line RR240 derived from Courtot with the HMW glutenin profile Dx2þDy12 Bx7þBy8 Dx2þDy12ontherespectivegroup1chromosomes1A1Band1D wasobtainedthroughhomoeologousrecombination.Asegmentof Courtotchromosome 1Dcontaining the Glu-D1 locus encoding the Dx2þDy12 subunits was translocated to the long arm of chro- mosome 1A in the absence of the Ph1 gene Dumur et al. 2009. 2.2. Yield trials Field trials of the translocated line RR240 and Courtot were conductedatRennesandClermontFerrandin2001andatRennes Le Moulon and Clermont Ferrand in 2002. In 2001 the genotypes weresownwithoutreplications.In2002theexperimentaltrialwas arandomizedblockwithtworeplicationsandaplantingrateof250 grains per square meter except at Clermont Ferrand where only one replication was performed. Both lines were grown under commonculturalpractices.Fromthetrialsperformedin2002data were collected for yield T/ha plant height cm and 1000-kernel weight g. 2.3. Protein extraction and electrophoresis Storage proteins were sequentially extracted from individual seeds according to the procedure described by Singh et al. 1991. The amount of glutenins and gliadins was quantified using the turbidimetric procedure of Vera 1988. For each individual glu- tenin extract10mg in total of HMW-GS and LMW-GS were loaded on Sodium Dodecyl Sulfate Polyacrylamide Gels SDS-PAGE with T¼12.5andC¼0.97foracrylamidegelparametersandseparated using SDS-PAGE. The Coomassie Blue gels stained according to Neuhoff et al. 1988 were scanned and the one dimensional glu- tenin profiles were analyzed using ‘‘Quantity one’’ software BioRad Hercules CA USA. A minimum of four replicates were analyzed per sample to be compared. 2.4. Technological evaluation Both Courtot and RR240 lines were tested for quality traits. Grain protein content GPC and grain hardness GH were evalu- atedforthetwoexperimentalyearsusingnearinfraredreflectance spectrometry NIRSfromwholemealflourproduced on aCyclotec 14920 mill Hillero ¨d Denmark according to AACC 39-25 1999 and AACC 39-70A 1999 respectively. The Zeleny sedimentation ZS test AFNOR NF V03-704 1997 modified by Branlard et al. 1991andtheHagbergfallingnumberHFNAFNORNFV03-703 1997 were assessed on white flour 70 extraction rate obtained in using the Brabender quadrumat Senior mill from seeds of the multilocal trials performed in 2002. This flour was also used for bread-making tests. Small amount of seeds were milled using the Chopin Dubois CD1millTripetteRenaudVilleneuveLaGarenneFrancegiving a white flour with 70 extraction rate. Protein content and mois- turelevelmeasuredbyNIRSonthiswhiteflourwereusedtogether with grain hardness for calculating the amountof water to add for performing the Mixograph test Martinant et al.1998. The 10-g Mixograph Natl. Manufacturer Lincoln Nebraska USA was performed according to the approved method AACC 54- 40A 1999 on samples for the two experimental years and eleven parameters computed by the Mixsmart software were used. The Chopin Alveograph test was used to assess dough strength W tenacity P extensibility L and the dough swelling Gas described by AFNOR NF ISO 5530-4 1997. The ratio tenacity/ extensibility P/L and the elasticity index I e were also calculated from the Alveograph curve. The curves and parameters were computed with the Alveolink apparatus Tripette Renaud Ville- neuve La Garenne France. TheFrenchbread-makingtestwasperformedusingtheCNERNA methodRoussetandAutran1979on2.5kgofwhitefloursamples obtained using a Brabender Senior mill from trials performed at Rennes and Le Moulon. Among the different parameters recorded during bread-baking bread volume and the synthetic quality gradesofthedoughonascaleof100thebreadonascaleof200 andtheirtotalwereused.Thistotalonascaleof300constituted the final grade of the CNERNA bread-making. 2.5. Statistical analysis Statistical analysis was performed using Statgraphics 5.5 soft- ware. The general linear model GLM procedure was used for varianceanalysisonyieldtrialsaswellasonbread-makingquality data to test the location effect and also the genotypic effect asso- ciated with the duplication of HMW-GS encoded at Glu-D1a. The mean values were compared according to Fisher’s least significant difference LSD procedure. 3. Results 3.1. Agronomic evaluation BothCourtotandRR240wheatlineswerecharacterizedinfield trials at Rennes Le Moulon and Clermont Ferrand in 2002. Due to the climatic condition observed at Clermont Ferrand during the experimentaltrialin2002andintheabsenceofreplicationresults obtainedforyieldand1000-kernelweightwerenotretainedinthe statistical analyses. A highly significant genotypic difference was found for both grain yield P0.05 and 1000-kernel weight P0.001theparentallineCourtotexhibitinghigherresultsthan J. Dumur et al. / Journal of Cereal Science 51 2010 175–181 176

slide 4:

thoseofthederivedlineRR240Table1.Theyieldwasonaverage 6.8T/hafortheRR240lineand9.2T/haforthecultivarCourtot.The lower yield of the RR240 linewas associated with the lower 1000- kernel weight 45g as compared to Courtot 53g. These two parameters were also significantly influenced by the experimental trial locations. The plant height did not differ between both lines and no significant effect was found. 3.2. Glutenin analysis The one dimensional SDS-PAGE of the HMW-GS and LMW-GS Fig. 1 clearly demonstrated the absence of the Glu-A1 subunit Ax2 aswellasvisualquantitativedifferencesforsomeHMW-GSin the RR240 cultivar as compared to Courtot. Statistical comparison of the total amount of HMW-GS and of LMW-GS did not reveal significant difference between Courtot and its derivative RR240 line.SignificantdifferenceswereobservedforGlu-B1x7Glu-D1x2 andGlu-D1y12whichweredecreasedto25andincreasedto93 and 38 respectively in RR240 as compared to Courtot Table 2. 3.3. Grain quality characteristics Both lines were field tested at two locations Rennes Clermont Ferrand in 2001 and at three locations Rennes Le Moulon Cler- mont Ferrandin 2002. Meanline value computedforeach quality parametergrainproteincontentGPCgrainhardnessGHZeleny sedimentation ZS and Hagberg falling number HFN exhibited little variation Table 3. In 2001 because of elevated grainprotein content in RR240 and Courtot in both trial locations statistical differences were less pronounced. Results of the second experi- mental year only are presented in Table 3. GPC and GH were not statisticallyaffectedbyduplicationoftheGlu-D1locus.Theaverage values of the GPC were 14.7 for the RR240 line and 13.9 for Courtot. The GH values were 76.6 and 81.8 for RR240 and Courtot respectively and allowed classification of both as medium hard bread wheat lines. However the statistical analysis has shown that GPC was significantly influenced by the year P0.05 higher values being observed in 2001. The Zeleny sedimentation test revealed a variation which was also confirmed by the Alveograph parameters. The ZS test per- formedfromthe2002experimentaltrialsindicatedthattheRR240 line duplicated for the Glu-D1 locus had higher sedimentation values average value¼53.3ml than the parental line Courtot 45.3ml although no significant difference was found in GPC Table 3. Moreover the ZS values were significantly influenced by the trial locations. Significant genotypic difference was also found forthespecificsedimentationvolumeSSVbetweenthetwolines. The Hagberg falling number HFN which is a method for measuring the starch liquefaction by a-amylase revealed no significant differences between the two sample types the HFN mean values varied between 373 and 375s. 3.4. Rheological tests To assess the impact of changes in gluten composition on the functional properties of the grain flour samples of Courtot and RR240 lines were analyzed using a 10-g mixograph test which measures the resistance of dough during mixing. A range of parameters were measured including the time required to reach the peak dough resistance MPT the midline right peak width MRW these latter showing the most significant genotypic differencesTable3.Theincreasedmixingrequirementanddough Table 1 Mean values of some agronomic characteristics obtained for the line RR240 and Courtot in the trials performed in 2002 at Rennes RE Le Moulon LM and Cler- mont Ferrand CF. Parameters Unit Location RR240 Courtot Significant effects a Genotype Location Height cm RE 79 70 LM 63 69 CF 63 60 1000-kernel weight g RE 43 52 LM 47 54 Yield T/ha RE 8.0 9.6 LM 5.6 8.7 a P0.05 P0.01 P0.001. Fig.1. SDS-PAGE of two glutenin extracts of Courtot and of RR240. Table 2 Meanvalues SDofpercentageofHMW-GSLMW-GSandindividualpercentageof HMW glutenin subunits comparison between Courtot and RR240 line. The mean valueswerecomputedfromfourindividualreplicatesof10mgofgluteninseparated using SDS-PAGE. Unit b Courtot RR240 Significant genotypic effect a Total Glutenin HMW-GS 18.89 2.022 20.25 0.239 LMW-GS 81.32 1.877 78.43 4.101 HMW-GS Glu-A1x2 1.55 0.993 Glu-B1x 7 6.51 1.062 4.88 0.725 Glu-B1y 8 2.88 1.298 2.91 0.877 Glu-D1x 2 2.69 0.444 5.19 0.379 Glu-D1y 12 5.26 0.656 7.28 0.333 a P0.05 P0.01 P0.001. b Percent of total glutenin subunits separated on 1 dimensional gel. J. Dumur et al. / Journal of Cereal Science 51 2010 175–181 177

slide 5:

stabilityindicatedthattheglutenfromRR240wasstrongertimeto peak resistance¼3.42min in comparison to the control line Courtot2.74min.NocorrelationwasfoundbetweentheGPCand MPT or MRW suggesting that overall differences between both linesfor theMixographvaluesweredue toqualitativedifferences in protein composition rather than to quantitative differences in GPC. Significant effect of locationwas found for all the parameters of the Mixograph except for the midline peak width. The Alveograph curves revealed differences between the two linesFig.2butstatisticalanalysisshowedthatthetenacityPthe swelling G and the extensibility were not significantly affected whereas the dough strength W the elasticity index I e and the ratiotenacity/extensibilityP/LwerehigherintheRR240linethan inthecontrollineTable3.AmongstalltheAlveographparameters recorded the dough strength W was the most consistent char- acterovertheyearsandlocations.Theresultsclearlydemonstrated that duplication of the Glu-D1 locus increased the W values: on averageþ46.8forRR240comparedtoCourtot.Moreoverahighly significant genotypic effect was observed for the dough elasticity index I e the average value of RR240 being higher I e ¼59.0 than that of Courtot I e ¼46.7. The higher elasticity index is consistent with higher dough strength of the RR240 line. Except for the tenacity many Alveograph parameters had a significant location effect. 3.5. Baking test No significant differences were detected for the baking param- eters although the score values of RR240 were observed to be higher than in Courtot Table 4. That result was mainly due to differences in magnitude of the baking values of the line RR240 rather than to a change in rank. However the dough kneading was significantly influenced by the genotype. 4. Discussion 4.1. Agronomic evaluation Regardingthegenotypiceffectsonagronomiccharacteristicsthe yieldand1000-kernelweightshowedstatisticaldifferencesbetween thetwogenotypes.Theresultsdocumentedayielddecreaseby26in theRR240lineandsuggestedalinkagebetweenthetranslocationand theyieldreduction.IntheRR240linetheyielddecreaseisapparently related to the lower 1000-kernel weight and to the lower grain numberperspikedatanotshown.Theseresultscouldbecausedby the less regular meiotic pairing at metaphase I of the RR240 line resulting in a lower fertility. In the partially isohomoeoallelic line RR240 a chromosome segment carrying the Glu-D1 locus has been transferred from chromosome 1D into 1A through homoeologous recombination. Genomic in situ hybridization indicated that the translocated 1A chromosome had a terminal 1DL segment repre- senting on average 25 of the length of the recombinant long arm. Thus an inter-chromosome pairing at metaphase I was observed in disomicplantsbetweenthe1AS.1AL–1DLchromosomeanditsdonor Table 3 Mean values over three locations of some quality characteristics of Courtot and its derivative line RR240 tested in trials performed in 2002. Variate Unit Courtot RR240 Significant effects a average SD average SD F Genotype F Location Grain protein content GPC dw 13.9 0.18 14.7 0.25 Grain hardness GH 81.8 2.36 76.6 3.34 Zeleny sedimentation ZS mL 45.3 0.81 53.3 1.15 Specific sedimentation volume SSV mL/prot 3.2 0.08 3.7 0.11 Hagberg falling number HFN s 375 7.1 373 10 Alveograph Tenacity P mmH 2 O52 1.25 58 1.77 Extensibility L mm 193.1 5.54 185.6 7.83 Dough swelling G cm 3 30.8 0.47 30.2 0.66 Strength W 10 4 J 216.3 10.1 317.6 14.2 Tenacity/Extensibility P/L mmH 2 Omm 1 0.281 0.007 0.313 0.01 Index of elasticity I e _ 46.7 0.51 59 0.72 Mixograph Midline left of peak value MLV 41 0.23 44 0.32 Midline left of peak width MLW 30.8 0.64 33.4 0.9 Midline peak time MPT min 2.74 0.03 3.42 0.05 Midline peak value MPV 47.3 0.47 51.7 0.67 Midline peak width MPW 25.5 0.93 27 1.31 Midline right of peak value MRV 39.7 0.27 42.3 0.38 Midline right of peak width MRW 10.7 0.11 13.1 0.15 Midline time X¼8min value MTxV 34.6 0.22 35.6 0.31 Midline time X¼8min width MTxW 4.9 0.07 5.5 0.11 Midline time X¼8min integral MTx Int min 303.4 1.9 316.7 2.6 Weakening slope WS 7.5 0.37 9.4 0.52 a P0.05 P0.01 P0.001. Fig. 2. Typical alveograph diagram of Courtot lower curve and its derivative line RR240 each performed on 5 dough trials. J. Dumur et al. / Journal of Cereal Science 51 2010 175–181 178

slide 6:

homoeologue1DDumuretal.2009.Thisproblemcouldberesolved sincewehaveplannedtoreducethetranslocatedsegmentinthelong arm of 1AS.1AL–1DL by means of homoeologous recombination to recovera stable version of that chromosome without the distal 1D- translocatedsegment. 4.2. Glutenin analysis No significant differences were found after one dimensional SDS-PAGEbetweenCourtotandRR240fortheamountofHMW-GS andLMW-GS.InRR240theabsenceofonlyonesubunitGlu-A1x2 is not sufficient to lower the total amount of HMW-GS which was not significantly increased although the duplication of the Glu-D1 locus resulted in a highly significant increase of the Glu-D1x and Glu-D1y subunits Table 2. Since the same quantity of Glutenin extract was loaded for each replicate for Courtot or for RR240 the higher amount of subunits Dx2 and Dy12 may have resulted in adecreaseofothersubunits.FortheGlu-B1locusonlysubunitGlu- B1x 7 was decreased. Consequently we can suspect that Glu-B1x7 wasgeneticallydownregulatedinresponsetotheincreaseddosage of subunits Dx2 and Dy12 since subunit By8 remained quantita- tively constant between Courtot and RR240. Wanous et al. 2003 reportedthenegativeeffectofchromosomearm1DLwhichcarries the Glu-D1 locus on expression of genes at the Glu-B1 locus. It was postulated that the negative effect may be attributable to compe- tition between these orthologous genes for shared transcription factors rather than to a regulatory locus on 1DL. Thetotalstorageproteinsofthetranslocatedlinewereanalyzed inusing2dimensionalelectrophoresisDumuretal.2009which showed that only the amount of subunit Dy12 was increased between 140 and 200 for the two isoform spots. The 3 spots corresponding to each subunit Dx2 and Bx7 were not significantly different in RR240. Two reasons may be invoked to explain the discrepancy: first the proteomic analysis was performed on iden- tical amounts of total storage proteins for Courtot and RR240 and notforthegluteninfractiononlysecondlystatisticalcomparisons betweenindividualspotvolumesmaynotbesignificantlydifferent although their cumulative amount after 1D SDS-PAGE was signifi- cant. The over-expression of the subunit Dx2 compared to Dy12 shown here using 1D SDS-PAGE is not consistent with the expression of transgenic elements from their own endosperm- specificpromoters.IntransgenicwheatlinesinwhichtheHMW-GS are expressed under control of their native promoter and tran- scription termination sequences the larger glutenin subunits x-typeshowedingeneralaloweraccumulationthanthesmaller subunits y-type Blechl et al. 2007 Bregitzer et al. 2006. 4.3. Grain quality Duplication of the Glu-D1 locus and the removal of the Glu-A1 locus encoding the HMW-GS Ax2 did not significantly affect GPC and GH which were mainly influenced by the year and the trial locationTable3.Thesignificantgenotypicdifferencedetectedfor theZStestandtheSSVindicatedthatthegrainproteincontentwas modifiednotinquantitybutinitscompositionintheRR240lineas compared with the control line Courtot. Introduction of the Glu- D1aallelehasalreadybeenfoundtoincreasesignificantlytheSDS- sedimentation value of a series of D-chromosome substitutions in hexaploid triticale Kazman and Lelley 1994. Similarly Rogers et al. 1990 found in the cultivar Chinese Spring that the chro- mosome 1B interacts with 1D to give a higher sedimentation volume than expected based on a purely additive model. The RR240 line exhibited statistically significant increases in dough parameters particularly for the Alveograph parameters doughstrength Wand elasticity index I e and for the Mixograph parameters:themidlinepeaktimeMPTandmidlinerightofpeak width MRW. It is well known that the time required to reach the peak dough resistance varied according to the genotype and particularly increased with the Glu-1 quality score but was found negatively correlated with the protein content Martinant et al. 1998. However in our study the protein content was similar for both the control and translocatedlines. The dough strength Wand elasticity index I e are generally positively correlated with the GPC and GH in bread wheat Branlard et al. 2001 Oury et al.1999. In our study the absence of variation of these two grain parameters GPC and GH between both lines clearly indicated that quality increase resulted from the duplication of the Glu-D1 locus and to the increased number of HMW subunits in the RR240 line six genes encoding HMW glutenin subunits instead of five. This showed that the duplicated HMW glutenin subunits Dx2þDy12 had higher positive effect than the HMW-GS Ax2 encoded at Glu- A1. Likewise because each subunit accounts for about 2 of the total grain protein Halford et al. 1992 the variation in gene number and then in gene expression resulted in differences in the totalamountofHMWgluteninsubunitsandhenceintheamountof elastic HMW polymers modifying dough strength parameters Lawrence et al.1988 Rogers et al.1990 2001. Even if the Glu-D1a allele is usually found in wheats of lower bread-making quality in comparisonwith the Glu-D1d allele and gives rise to lower gluten strength Payne 1987 duplication of subunits Dx2þDy12 results in a stronger gluten which forms an enhanced network in dough and increases gluten elasticity. Moreover the duplication of the Glu-D1a allele did not reduce the dough extensibility L. Manipulation of the Glu-D1 locus has been previouslysuggestedinmanyworksasameanstoimprovebaking qualityofhexaploidwheatandtriticale.Studyingthegluteninsand gliadinsinthenullisomic–tetrasomiclinesofChineseSpringN1A- T1DandN1B-T1DRogersetal.1990foundthatchromosome1D carryingtheGlu-D1a2þ12allelehadthestrongestpositiveeffect onbakingqualitycomparedtochromosome1B7þ8and1Anull allele. They also proposed to increase dosage of the Glu-D1d 5þ10 considered in wheat as the best Glu-D1 allele to improve baking quality and remove the negative impact on quality of chromosome1AcarryingtheGlu-A1cnullallele.Anapproachhas been exploited through transgenic experiments. Over-strong mix- ing characteristics have also been reported for transgenic wheat cultivars which contain elevated amounts of subunits Dx5 and Dy10 Barro et al.1997 Blechl et al. 2007 Popineau et al. 2001. Over-expression of Dx5 or Dy10 is often associated with dramatic increase in dough strength not suitable for bread-making Blechl et al. 2007 Rooke et al. 1999. In our case the dough kneading parameter was improved and this reported negative impact is not observed since no significant changes were observed in bread scores and loaf volume Table 4. This could be due tothe fact that theFrenchbread-bakingtestispartlyinfluencedbydiversityofthe HMW-GSencodedatthethreeloci.Ouryetal.2010reportedthat Table 4 Mean values of the bread-making parameters using the CNERNA method obtained for the two lines tested in experimental trials performed at Rennes and Le Moulon in 2002. Variate Unit Courtot RR240 P Genotype average SD average SD Dough kneading /20 13.2 0.25 16 0.35 P0.05 Loaf volume cm 3 1403 64 1591 91 P¼0.19 Specific bread loaf volume cm 3 /prot 106.9 5.1 107.7 7.2 Dough score /100 66 1.8 72 2.6 P¼0.13 Bread score /200 130 6.6 142 9.3 P¼0.36 Total Bread score /300 196 7.6 215 10.8 P¼0.25 J. Dumur et al. / Journal of Cereal Science 51 2010 175–181 179

slide 7:

lessthan20ofthebread-bakingscoresandloafvolumevariations were explained by the genetic diversity of the HMW-GS. The absence of a negative effect also could result from changes in the Dx/Dy ratio and the HMW glutenin ratio x-type/y-type. In bread wheatx-typesubunits areusuallyhighlydominant in comparison to y-type subunits and represent 68 and 32 of the relative contentoftheHMWgluteninsubunitsinflourrespectivelyWieser and Zimmermann 2000. These x-type and y-type subunits represent for Courtot 57.0 and 43.0 and for RR240 49.8 and 50.2 respectively Table 2. The translocation greatly increased the y-type percentage. Consequently the Dx/Dy ratio was reduced from1.32inCourtotto0.99inRR240.Thesevariationsmayinduce changes in the structure and properties of the glutenin polymers Butow et al. 2003. The beneficial effect of a decreased ratio of x-type/y-type subunits on bread-making quality was recently reported by Leo ´n et al. 2009 in a transgenic bread wheat line cv. Anza.InparticulartheexpressionofsubunitDy10associatedwith achangeoftheratioofx-type/y-typesubunitsfrom1.25to0.91in the control line and in the transgenic line T590 respectively had the greatest impact on wheat flour properties such as dough stability Mixograph mixing time and the Alveograph W value. 5. Conclusion The partially isohomoeoallelic line RR240 was found to have improved dough and mixing characteristics. Stronger gluten was significantly observed in the measurements of the Zeleny sedi- mentation volume in the mixing peak time MPT and midline right of peak width MRW the dough strength W the elasticity index I e and the ratio tenacity/extensibility P/L. The importance of the duplicated HMW glutenin subunits Dx2þDy12 is quite obvious.Thequalityofwheatcultivarsdependsonthenumberand compositionofsubunitspresentandtheincreaseinthenumberof HMW-GS resulting from the duplication of the Glu-D1a allele enhanced dough elasticity and resistance to some degree. It appears to be of particular interest in triticale and wheat breeding programs when a stronger mixing character is desired. This bene- ficial effect issued from natural genetic crossing was obtained without any negative effects as reported in transgenic wheat for the Glu-D1d allele. Moreover such lines offer the possibility to combine in a given genotype two Glu-D1 alleles with comple- mentary effect: Glu-D1a often associated with dough extensibility and Glu-D1d to tenacity and strength. The partially iso- homoeoallelic line RR240 was however of lower agronomic performance for 1000-kernel weight and yield. A stable version of the 1AS.1AL–1DL chromosome without the distal 1D-translocated segment could be easily recovered which should induce a more regular meiotic pairing and then a yield comparable to that of the control line Courtot. That requirement is a necessity beforerelease for commercial production. Acknowledgements The authors are very indebted to Rene ´ Saccomano y who contributedtofieldexperimentsandqualityevaluationoftheplant material. AnnieFaye is alsothanked forherassistancein analyzing the storage proteins and Nicolas Guilhot for computing assistance. References AACC 39-251999. Near infrared method for protein content inwhole-grainwheat. In: AACC Ed. Approved Methods of the American Association of Cereal Chemist 3340 Pilot Knob r. St Paul MN U.S.A vol. 2 pp.1–3. AACC39-70A1999.Wheathardnessasdeterminedbynear-infraredreflectance.In: AACC Ed. Approved Methods of the American Association of Cereal Chemist 3340 Pilot Knob r. St Paul MN U.S.A vol. 2 pp.1–3. AACC 54-40A 1999. Mixograph method. In: AACC Ed. Approved Methods of the American Association of Cereal Chemist 3340 Pilot Knob r. St Paul MN U.S.A vol. 2 pp.1–6. AFNOR NF ISO 5530-4 1997. De ´termination des caracte ´ristiques rhe ´ologiques au moyen de l’alve ´ographe. In: AFNOR Ed. Ce ´re ´ales et produits ce ´re ´aliers. Association Française de Normalisation 92049 Paris La De ´fense pp. 307–322. AFNORNFV03-7031997.De ´terminationdel’indicedechuteselonHagberg-Perten. In: AFNOR Ed. Ce ´re ´ales et produits ce ´re ´aliers. Association Française de Nor- malisation 92049 Paris La De ´fense pp. 285–295. AFNOR NF V03-704 1997. De ´termination de l’indice de se ´dimentation: test de Zeleny.In:AFNOREd.Ce ´re ´alesetproduitsce ´re ´aliers.AssociationFrançaisede Normalisation 92049 Paris La De ´fense pp. 285–306. BarroF.Rooke L.Be ´ke ´sF.GrasP.TathamA.S.FidoR.LazzeriP.A.Shewry P.R. Barcelo P.1997. Transformation of wheat with high molecular weight subunit genes results in improved functional properties. Nature Biotechnology 15 1295–1299. Bittel D.C. Hueros G. Jouve N. Gustafson J.P. 1991. Changes in expression of seed storage protein genes affected by chromosome 1D of wheat. Genome 34 845–848. Blanco A. Cenci A. Simeone R. Gadaleta A. Pignone D. Galasso I. 2002. The cytogenetics and molecular characteristics of a translocated chromosome 1AS.1AL–1DL with a Glu-D1 locus in durum wheat. Cellular and Molecular Biology Letters 7 559–567. BlechlA.LinJ.NguyenS.ChanR.AndersonO.D.DupontF.M.2007.Transgenic wheats with elevated levels of Dx5 and/or Dy10 high-molecular-weight glu- tenin subunits yield doughs with increased mixing strength and tolerance. Journal of Cereal Science 45 172–183. Branlard G. Rousset M. Loisel W. Autran J.C. 1991. Comparison of 46 techno- logicalbreedingcriteriausedbreadwheatqualityevaluation.JournalofGenetic and Breeding 45 263–280. Branlard G. Pierre J. Rousset M.1992. Selection indices for quality evaluation in wheat breeding. Theoretical and Applied Genetics 84 57–64. Branlard G. Dardevet M. Saccomano R. Lagoutte F. Gourdon J. 2001. Genetic diversity of wheat storage proteins and bread wheat quality. Euphytica 119 59–67. Bregitzer P. Blechl A.E. Fiedler D. Lin J. Sebesta P. Fernandez de Soto J. Chicaiza O. Dubcovsky J. 2006. Changes in high molecular weight glutenin subunit composition can be genetically engineered without affecting wheat agronomic performance. Crop Science 461553–1563. Butow B.J. Tatham A.S. Savage A.W.J. Gilbert S.M. Shewry P.R. Solomon R.G. Be ´ke ´s F. 2003. Creating a balance – the incorporation of a HMW glutenin subunit into transgenic wheat lines. Journal of Cereal Science 38 181–187. Dumur J. Branlard G. Tanguy A.-M. Dardevet M. Coriton O. Huteau V. Lemoine J. Jahier J. 2009. Development of isohomoeoallelic lines within the wheat cv. Courtot for high molecular weight glutenin subunits: transfer of the Glu-D1 locus to chromosome 1A. Theoretical and Applied Genetics 119 471–481. Halford N.G. Field J.M. Blair H. Urwin P. Moore K. Robert L. Thompson R. Flavell R.B. Tatham A.S. Shewry P.R. 1992. Analysis of HMW glutenin subunits encoded by chromosome 1A of bread wheat Triticum aestivum L. indicates quantitative effects on grain quality. Theoretical and Applied Genetics 83 373–378. JoppaL.R.KlindworthD.L.HarelandG.A.1998.Transferofhighmolecularweight glutenins from spring wheat to durum wheat. In: Slinkard A.E. Ed. Proceeding of the Ninth International Wheat Genetics Symposium Saskatoon Canada 2–7 August. University of Ext. Press University of Saskatchewan Saskatoon SK Canada pp. 257–260. Kazman M.E. Lelley T.1994. Rapid incorporation of D genome chromosomes into A- and/or B genomes of hexaploid triticale. Plant Breeding 113 89–98. Klindworth D.L. Hareland G.A. Elias E.M. Xu S.S. 2005. Agronomic and quality characteristics of 1AS. 1AL–1DL translocation lines of durum wheat carrying glutenin allele Glu-D1d. Crop Science 45 77–84. Lawrence G.J. Mac Ritchie M. Wrigley C.W. 1988. Dough and baking quality of wheat lines deficient in glutenin subunits controlled by the Glu-A1 Glu-B1 and Glu-D1 loci. Journal of Cereal Science 7109–112. Leo ´n E. Marı ´n S. Gime ´nez M.J. Piston F. Rodrı ´guez-Quijano M. Shewry P.R. BarroF. 2009. Mixingpropertiesand dough functionalityof transgenic lines of a commercial wheat cultivar expressing the Ax1 Dx5 and Dy10 HMWglutenin subunit genes. Journal of Cereal Science 49 148–156. Lukaszewski A.J. Curtis C.A.1992. Transfer of the Glu-D1 gene from chromosome 1Dofbreadwheattochromosome1Rinhexaploidtriticale.PlantBreeding109 203–210. Lukaszewski A.J. Curtis C.A.1994. Transfer of the Glu-D1 gene from chromosome 1D to chromosome 1A in hexaploid triticale. Plant Breeding 112177–182. Martinant J.P. Nicolas Y. Bouguennec A. Popineau Y. Saulnier L. Branlard G. 1998. Relationships between mixograph parameters and indices of grain quality. Journal of Cereal Science 27179–189. NeuhoffV.AroldN.TaubeD.EhrhardtW.1988.Improvedstainingofproteinsin polyacrylamidegelsincludingisoelectricfocusinggelswithclearbackgroundat nanogram sensitivity using Coomassie Brilliant Blue G-250 and R-250. Elec- trophoresis 9 255–262. Oury F.-X. Chiron H. Pichon M. Giraud A. Be ´rard P. Faye A. Brancourt- HumelM.RoussetM.1999.Reliabilityofindirectselectionindeterminingthe quality of bread wheat for French bread-baking. Agronomie 19 621–634. J. Dumur et al. / Journal of Cereal Science 51 2010 175–181 180

slide 8:

Oury F.-X. Chiron H. Faye A. Gardet O. Giraud A. Heumez E. Rolland B. Rousset M. Trottet M. Charmet G. Branlard G. 2010. The prediction of bread wheat quality: joint use of the phenotypic information brought by technolog- ical tests and the genetic information brought by HMW and LMW glutenin subunits. Euphytica 171 doi:10.1007/s10681-009-9997-1. Payne P.1987. Genetics of wheat storage proteins and the effect of allelic variation on breadmaking quality. Annual Review of Plant Physiology 38141–153. Popineau Y. Deshayes G. Lefebvre J. Fido R. Tatham A.S. Shewry P.R. 2001. Prolamin aggregation gluten viscoelasticity and mixing properties of trans- genic wheat lines expressing 1Ax and 1Dx high molecular weight glutenin subunit transgenes. Journal of Agriculture and Food Chemistry 49 395–401. RogersW.Ritckatson J.SayersE.LawC.1990.Dosageeffects ofchromosomes of homoeologous groups 1 and 6 upon bread-making quality in hexaploid wheat. Theoretical and Applied Genetics 80 281–287. Rogers W.J. Sayers E.J. Ru K.L. 2001. Deficiency of individual high molecular weight glutenin subunits affords flexibility in breeding strategies for bread- making quality in wheat Triticum aestivum L. Euphytica 117 99–109. Rooke L. Be ´ke ´s F. Fido R. Barro F. Gras P. Tatham A.S. Barcelo P. Lazzeri P. ShewryP.R.1999.Overexpressionofaglutenproteinintransgenicwheatresults ingreatlyincreaseddoughstrength.JournalofCerealScience30115–120. Rousset M.AutranJ.-C.1979. Laqualite ´ desble ´s.In:CNRSEd.Actesdu Colloque CNERNA Paris France14–15 novembre 1977 Paris France pp.15–42. Singh N.K. Shepherd K.W. Cornish G.B. 1991. A simplified SDS-PAGE proce- dure for separating LMW subunits of glutenin. Journal of Cereal Science 14 203–208. Vera J.C. 1988. Measurement of microgram quantities of protein by a generally applicable turbidimetric procedure. Analytical Biochemistry 174187–196. Vitellozzi F. Ciaffi M. Dominici L. Ceoloni C.1997. Isolation of a chromosomally engineered durum wheat line carrying the common wheat Glu-D1d allele. Agronomie 17 413–419. Wanous M. Munkvold J. Kruse J. Brachman E. Klawiter M. Fuehrer K. 2003. Identification of chromosome arms influencing expression of the HMW glu- tenins in wheat. Theoretical and Applied Genetics 106 213–220. WelshJ.R.HehnE.R.1964.Theeffectofchromosome1Donhexaploidwheatflour quality. Crop Science 4 320–323. WieserH.ZimmermannG. 2000. Importance of amountsand proportionsofhigh molecular weight subunits of glutenin for wheat quality. European Food Research Technology 210 324–330. WrigleyC.Be ´ke ´sF.BushukW.2006.GliadinandGlutenintheUniqueBalanceof Wheat Quality. AACC International St Paul MN 55121 USA p. 466. J. Dumur et al. / Journal of Cereal Science 51 2010 175–181 181

slide 9:

The effects of puroindoline b on the ultrastructure of endosperm cells and physicochemical properties of transgenic rice plant NaokiWada a Shin’ichiroKajiyama b JoyceA.Cartagena c LinyenLin d YukioAkiyama e MotoyasuOtani f Go Suzuki g Yasuhiko Mukai g Noriaki Aoki h Kiichi Fukui a a Department of Biotechnology Graduate School of Engineering Osaka University 2-1 Yamadaoka Suita Osaka 565-0871 Japan b Department of Biotechnological Science School of Biology-Oriented Science and Technology Kinki University 930 Nishimitani Kinokawa Wakayama 649-6493 Japan c Department of Material and Life Science Graduate School of Engineering Osaka University 2-1 Yamadaoka Suita Osaka 565-0871 Japan d Research Center for Ultra-High Voltage Electron Microscopy Osaka University 7-1 Mihogaoka Ibaraki Osaka 567-0047 Japan e National Agricultural Research Center for Tohoku Region 4 Akahira Shimo-kuriyagawa Morioka Iwate 020-0198 Japan f Research Institute for Bioresources and Biotechnology Ishikawa Prefectural University Nonoichi Ishikawa 921-8836 Japan g Laboratory of Plant Molecular Genetics Division of Natural Science Osaka Kyoiku University 4-698-1 Asahigaoka Kashiwara Osaka 582-8582 Japan h National Institute of Crop Science 2-1-18 Kannondai Tsukuba Ibaraki 305-8518 Japan article info Article history: Received 13 August 2009 Received in revised form 23 October 2009 Accepted 20 November 2009 Keywords: Puroindoline b Rice endosperm Ultrastructure Physicochemical property abstract Endosperm texture is an important factor governing the end-product quality of cereals. The texture of wheat Triticum aestivum L. endosperm is controlled by puroindoline a and b genes which are both absentinriceOryzasativaL..Ithasbeenreportedthattheendospermtextureofricecanbemodifiedby puroindoline genes. The mechanism however by which puroindolines affect the ultrastructure of rice endosperm cells remains to be investigated. In this study we observed the ultrastructure of endosperm cells and the morphology of isolated starch granules of the transgenic rice expressing the puroindoline b gene.SEM and TEM observations indicated that compoundstarch granules wereembedded within the matrix material in non-transgenic rice Nipponbare whereas they were surrounded by spaces in the transgenic rice. The morphology and size of each starch granule were not different between non- transgenicandthetransgenicrice.Howeverthetransgenicriceflourshowedsmallerparticlesizehigher starch damage and lower viscosity during gelatinization than that of non-transgenic rice. These results confirm that puroindoline b reduces the grain hardness in rice. Moreover the results also suggest that puroindoline b functions at the surface of compound starch granules and not on polygonal starch granules in rice endosperm. 2009 Elsevier Ltd. All rights reserved. 1. Introduction Grain hardness is one of the most important determinants of cereal end-product quality. In wheat Triticum aestivum L. grain hardnesshasbeenreportedtocorrelatewithmanyflourproperties including particle size starch damage and water absorption Pomeranz and Williams1990 and it directly affects end-product quality.Forinstancesoftwheatflourisgenerallyusedforcakesand cookies while hard wheat flour is used for making breads. To evaluate and manipulate the end-product quality more effectively themolecular mechanismsofwheatgrainhardnesshave attracted much interest in recent years. Wheat grain hardness is controlled by the hardness locus Ha on the short arm of chromosome 5D Law et al. 1978. A 15 kDa proteincomplexproducedbyHatermedfriabilinwasfoundtobe correlated with endosperm texture. Friabilin was more abundant on soft wheat starch than on hard wheat starch Greenwell and Schofield1986. Puroindoline a PINA and puroindoline b PINB havebeenidentifiedasthecomponentsoffriabilinbasedontheirN terminalsequencesRahmanetal.1994.ThepuroindolineaPina and puroindoline b Pinb genes have been cloned and wereshown to encode wheat endosperm-specific lipid binding proteins with a unique tryptophan-rich domain Gautier et al.1994. This tryp- tophan-rich domain has been considered as being responsible for thestrongaffinityofPINstopolarlipidsMarionetal.1994.Ithas been suggested that these lipid/protein interfaces play an Abbreviations:Hahardnesslocus PinapuroindolineagenePINApuroindoline a protein Pinb puroindoline b gene PINB puroindoline b protein RT-PCR reverse transcription-polymerase chain reaction RVA rapid visco-analyzer SDS-PAGE sodiumdodecylsulfate-polyacrylamidegelelectrophoresisSEMscanningelectron microscopy TEM transmission electron microscopy. Corresponding author. Tel.:þ816 68797440 fax:þ81 6 68797441. E-mail address: kfukuibio.eng.osaka-u.ac.jp K. Fukui. Contents lists available at ScienceDirect Journal of Cereal Science journal homepage: www.elsevier.com/locate/jcs 0733-5210/ – see front matter 2009 Elsevier Ltd. All rights reserved. doi:10.1016/j.jcs.2009.11.010 Journal of Cereal Science 51 2010 182–188

slide 10:

important role in the texture of wheat endosperm by preventing theadhesionbetweenthestarchgranulesandsurroundingprotein matrix Morris 2002. Promoter analysis has shown that Pina and PinbgenesareexpressedonlyintheendospermWileyetal.2007 andimmunostainingstudieshaveshownthatPINsarelocalizedon the starch granule surface Feiz et al. 2009 Wiley et al. 2007. Based on these studies it has been assumed that PINs bound to lipid on the starch granule surfaces prevent the starch granules from being packed tightly resulting in the soft grain texture. PINA and PINB have 60 homology in their amino acid sequence.StudieshaveshownthatPINAhasagreaterroleforgrain hardness than PINB Capparelli et al. 2003 Corona et al. 2001. AdditionalstudiesshowedthatadditionofPINBwasmoreeffective atreducingthegrainhardnessHoggetal.2004andthatPINBwas the limiting factor in a sense as it assists PINA in binding to starch Swan et al. 2006b. Recently Wanjugi et al. 2007 indicated that PINA or PINB can act independently leading to intermediate- textured grainorcan function together togive a soft graintexture. Rice Oryza sativa L. is an important cereal and is also a model plant among monocotyledons. In addition rice does not contain PinA and PinB homologs. These characteristics make it a good model cereal to investigate the effect of PINs on the other cereals. Krishnamurthy and Giroux 2001 have already reported that expression of wheat Pins in transgenic rice M202 enhances grain softness.Howevertheultrastructureof transgenicriceendosperm cellshasnotbeeninvestigated.ExaminingtheeffectofPINsonthe structureofplantendospermcellswillbeusefultounderstandthe functions of PINs in more detail. Furthermore it will also help to collect additional knowledge to manipulate the grain hardness in other cereals. We have introduced the Aegilops tauschii D genome donor to common wheat genomic region containing the hardness genes into japonica rice cv. Nipponbare using a bioactive beads method and obtained homozygous transgenic rice stably expressing the Pinb gene Wada et al. 2009. In this study a homozygous trans- genicricelineexpressingPinbgeneintheT 4 generationwasusedto investigate the effect of the Pinb gene on the ultrastructure of the rice endosperm cells. In addition we also assessed the physico- chemical properties of transgenic rice flour. 2. Experimental 2.1. Plant materials The embryogenic rice calli induced from mature kernels were transformed as described in Wada et al. 2009. The T 4 kernels derived from the homozygous transgenic rice line 9-1-6-3 expressing A. tauschii Pinb gene were used throughout the study. Three transgenic and three non-transgenic plants were grown in potscontainingfertilizedgranulatedsoilsKurehaTokyoJapanin thegreenhouseat30 Catsametimeinthesummerof2008.Non- transgenic non-tissue culture derived plants nearly identical to transgenic plants in terms of their seed size protein content data not shown amylose content the shape and the size of isolated starch granules as described in Results section were used as control in this study. 2.2. Reverse transcription-polymerase chain reaction RT-PCR analysis RT-PCRwascarriedoutasmentionedinWadaetal.2009.Total RNAwas extracted fromfrozenT 4 transgenicleaves orkernels and subjected to DNase treatment. cDNA was synthesized from the solution.RT-PCRwasperformedwithprimersfortheactinandPinb genes.The actinprimerswereusedtoconfirmthecDNAsynthesis. The nucleotide sequences of the primers were as follows: actin F ACATCGCCCTGGACTATGAC actin Re TGGAATGTGCTGAGAGATGC Pinb F ATGAAGACCTTATTCCTCCTA Pinb Re TCACCAGTAA- TAGCCACTAGGGAA. The thermal cycle conditions for the RT-PCR wereasfollows:95 Cfor2minandthen35cyclesof95 Cfor15s 50 Cforactinprimeror55 CPinbprimerfor30sand72 Cfor 40 s. 2.3. Isolation of Triton X-114-soluble proteins and sodium dodecyl sulfate-polyacrylamide gel electrophoresis SDS-PAGE Triton-soluble proteins were isolated by phase partitioning of Triton X-114 as described in Wada et al. 2009. The pellet was dissolved in SDS sample buffer 4 SDS 10 sucrose in 125 mM Tris–HCl pH 6.8. SDS-PAGE was performed bya standard method Laemmlimethodusinga20gelandproteinswerevisualizedby silver staining using Sil-Best Stain-Neo NACALAI TESQUE Inc. Kyoto Japan according to the manufacturer’s instructions. 2.4. Scanning electron microscopy SEM Twokindsofsampleswerepreparedonewasthewholegrainof milled rice and another was isolated starch granule. For the whole grains individual grains were fractured by a razor blade with aslightpressureonthetopof thegrain.Fracturedricegrainswere immediately mounted on the specimen stage and the fractured surfaceofrice grainswasdirectedupward.The sampleswerethen coated with osmium 3 nm in thickness in an osmium plasma coater HPC-15 Vacuum Device Inc. Mito Japan and were observed under an SEM S-5200 Hitachi Tokyo Japan at 15 kV. Seven seeds were used for SEM observation. The isolated starch granules were prepared according to the protocol described by Fujita et al. 2003. Dried seeds of non-transgenic and transgenic plantsweredehulledandtheouterlayerof theseedwasremoved using a rice polisher Twinbird corporation Niigata Japan. The Fig.1. ExpressionanalysisofPinbRNAAandPINBproteinB.AThetemplatesused for RT-PCR reaction were as follows: lane 1: no template lane 2: non-transgenic rice leaf cDNA lane 3: non-transgenic rice kernel cDNA lane 4: transgenic rice leaf cDNA lane 5: transgenic rice kernel cDNA lane 6: transgenic rice genomic DNA. The primer sets used are shown on the left. B Triton X-114-soluble proteins extracted from kernels and subjected to SDS-PAGE and silver staining. Lane 1: non-transgenic rice kernels lane 2: transgenic rice kernels. Arrow indicates the expected size of PINB. N. Wada et al. / Journal of Cereal Science 51 2010 182–188 183

slide 11:

milled rice was ground into powder with mortar and pestle. The morphology of starch granules was examined under an SEM. The projected surface areas of each granule were measured using the Image J program http://rsb.info.nih.gov/ij/download. html to analyze the size distribution of isolated starch granules. 2.5. Transmission electron microscopy TEM Using a razor blade individual mature grains were first cut transverselyatthemidregionoftheendospermandthenwerecut longitudinally. These blocks were fixed with gas from 5 glutaral- dehyde in 0.2 M cacodylate buffer pH 7.4 for a week at room temperatureandpostfixedby2osmiumtetraoxidegasovernight at room temperature. The blocks were then dehydrated through a graded ethanol series followed by n-butyl glycidyl ether QY-1 and embedded in Qutol-651 NISSHIN EM Co. Ltd. Tokyo Japan. Sections were cut with a diamond knife on an ultramicrotome ULTRACUT E Leica Biosystems Nussloch GmbH NuBloch GermanyandexaminedunderaJEM-1200EXelectronmicroscope JEOL Tokyo Japan with an accelerating voltage of 100 kV. Three seeds per sample were used for TEM observation. 2.6. Damaged starch assay The quantity of damaged starch from rice flour was measured usingtheMegazymestarchdamageassaykitMegazymeInt’lLtd. Bray Ireland according to the manufacturer’s protocol. The anal- ysis was performed in duplicate and using average values of three independent samples. 2.7. Flour size distribution assay The milled rice was ground to flour using the vibrating sample mill model TI-100 CMT Co. Ltd. Tokyo Japan according to the manufacturer’sinstructions.Theflourparticlesizedistributionwas measured with a laser diffraction system HELOS RODOS Sym- patec GmbH Clausthal-Zellerfeld Germany according to the manufacturer’s protocol. The median diameter calculated was Fig. 2. SEM observation of rice endosperm cells. A B Low magnification view of transversely fractured surface of milled rice of A non-transgenic rice and B transgenic rice. Arrowheads indicate the intracellularlycleavedsite. Bars: 100mm. C D Higher magnification viewof intercellularlycleavedsite of C non-transgenic rice and D transgenic rice. C Compound starch granules circles are embedded within matrix material in non-transgenic rice. Intracellularly cleaved sites are also observed. D Starch compound granules circles are surrounded by airspaces arrowhead. Bars: 20 mm. E F Higher magnification view of intracellularly cleaved site of E non-transgenic rice and F transgenic rice. Partially split compound starch granules PS exposing individual starch granules with sharp angles and edges are observed. Bars: 20 mm. N. Wada et al. / Journal of Cereal Science 51 2010 182–188 184

slide 12:

chosen to characterize the flour particle size. The analysis was performed in duplicate. 2.8. Quantification of apparent amylose content The apparent amylose content was measured via an iodine colorimetric assay Juliano 1971 using an Auto Analyzer II Bran þ Luebbe Norderstedt Germany. The standard curve was constructed using different amounts of potato amylose Sigma Chemical Co. St. Louis USA and starch extracted from glutinous rice. Starch extraction was performed as described by Yamamoto et al. 1981. The reference sample Nipponbare whose amylose content is 19.2 supplied by Bran þ Luebbe Norderstedt Germany was used to correct the errors derived from rice components other than the starch. The sample analyses were repeated in triplicate. 2.9. Analysis of pasting properties ThepastingpropertiesoftheflourweremeasuredusingaRapid Visco-Analyzer RVA model 3D Newport Sydney Australia. The aqueous rice flour suspensions 14 w/w were prepared using 3.5 g of rice flour and 25 ml of distilled water. The applied temperatureprogramwasasfollows:1holdat50 Cfor1min2 increase 50–95 C for 4 min 3 hold at 95 C for 7 min 4 cool from 95 to 50 C for 4 min and 5 hold at 50 C for 3 min. The program was initiated by mixing at 960 rpm at 50 C for 10 s and amixingspeedof160rpmwasusedfortherestoftheprogram.The parameters recorded were initial gelatinization temperature peak viscosity hot paste viscosity final viscosity breakdown and setback. Rice flour samples were analyzed in triplicate. 3. Results 3.1. Expression analysis of the transgenic rice in T 4 generation Expression of the Pinb gene was confirmed at the RNA and proteinlevelsrespectively.AttheRNAleveltheexpressionofPinb gene under the A. tauschii PinB promoter was detected only in kernels not in leaves Fig. 1A. At the protein level an approxi- mately 15 kDa specific band was observed in transgenic rice by silverstainingFig.1B.Thisresultwasconsistentwiththeprevious result obtained with the transgenic rice inT 2 generation inwhich thePINBwasidentifiedfromthe15kDaspecificbandWadaetal. 2009.TheseresultsindicatedthatPINBwasexpressedstablyinthe transgenic rice kernels used in this study. 3.2. SEM observation of the fractured surface ToinvestigatetheeffectsofthePinbgeneonthestructureofrice endosperm cells the transversely fractured surface of milled rice was observed under SEM. As shown in Fig. 2A and B two types of endosperm cell morphology were observed depending on the position where the cleavage occurred. In the area where the cleavage occurred between cells the surface was smooth and individualcellscouldbeidentifiedbyangledshapeFig.2CandD. In the area where the cleavage occurred within cells the surface was rough and the individual cells could not be identified because of the disruption of cell morphology Fig. 2E and F. In this area partiallysplitcompoundstarchgranulesexposingindividualstarch granules with sharp angles and edges were observed in various shapes and sizes. Fig.3. Morphologyandsizeofisolatedstarchgranules.ABThemorphologyofisolatedstarchgranulesfromAnon-transgenicriceandBtransgenicrice.Botharepolygonalin shape with sharp angles and edges indicating no differences between them. St indicates starch granules. Bars: 5 mm. C Size distribution of isolated starch granules. N. Wada et al. / Journal of Cereal Science 51 2010 182–188 185

slide 13:

In non-transgenic rice the tightly packed compound starch granules were observed in the area where the cleavage occurred betweencellsFig.2C.Allofthespacesbetweencompoundstarch granules were filled with matrix material. In contrast spaces between each compound starch granules were observed in the transgenic rice expressing Pinb gene Fig. 2D. The compound starch granules varied in sizes and were not tightly packed. The matrix material did not fill the spaces between compound starch granules. Instead airspaces surrounded the compound starch granules. Inthe placewherethecleavageoccurred within cells no difference was observed between non-transgenic rice and the transgenic rice Fig. 2E and F. 3.3. SEM observation of isolated starch granules The morphology and size of isolated starch granules were investigated by SEM. As shown in Fig. 3 no clear difference was observedbetweennon-transgenicriceandthetransgenicrice.Both of them consisted of polygonal starch granules with sharp angles and edges. To analyze the size distribution of isolated starch granules the projected area of each starch granule was calculated. The result indicated that their differences were not significant statistically p¼ 0.11 t-test. 3.4. TEM observation of rice endosperm cells Tofacilitateamoredetailedobservationof theultrastructureof endosperm cells in the transgenic rice the central region of rice grain was observed under a TEM. Endosperm cells were typically occupied by compound starch granules Fig. 4A and B. In non- transgenic rice compound starch granules were compacted togethermakingitdifficulttodistinguishtheindividualcompound starch granules Fig. 4A. Most of the compound starch granules weresurroundedbythespaceinthetransgenicriceandindividual compound starch granules could be identified even when numerous compound starch granules were present within a small area Fig. 4B. Each compound starch granule consisted of a number of starch granules. In both non-transgenic rice and the transgenic rice the spaces between starch granules were sometimes observed. 3.5. Flour particle size starch damage apparent amylose content Many studies have reported that PINB confers grain softness which correlates with flour size distribution and starch damage Beecher et al. 2002 Brites et al. 2008 Martin et al. 2007 2008. Therefore the flour size distribution and starch damage of the transgenic rice were analyzed. As shown inTable 1 the transgenic riceshowedsmallerparticlesizemedianvalue:74 2.4mmthan non-transgenic rice 100.7 5.1 mm. The starch damage was higher in the transgenic rice 8.6 0.2 than in non-transgenic rice 7.9 0.1. The apparent amylose content was not different between them 14.2 in non-transgenic rice and 14.3 in the transgenic rice. 3.6. Pasting properties of transgenic rice flour Table2showsthepastingviscosityprofileofnon-transgenicrice andthetransgenicrice.Thetransgenicriceshowedlowerviscosity during gelatinization than non-transgenic rice. The statistically significant differences were as follows: 73 RVU peak viscosity 29 RVU hot past viscosity 43 RVU breakdown 35 RVU final viscosity. The setback peak time and initial gelatinization temperaturevalueswerenotdifferentbetweennon-transgenicrice and the transgenic rice. The pasting viscosity profile was also analyzedintheT 3 generationwhichshowedsimilardifferencesin pasting viscosity profile between non-transgenic rice and the transgenic rice data not shown. 4. Discussion In this study homozygous transgenic rice in the T 4 generation was used to investigate the effect of PINB on the ultrastructure of the endosperm cells and physicochemical properties of the rice flour.TheexpressionofthePinbgenewasconfirmedbyRT-PCRand Fig.4. TEMobservationofstarchendospermcellsfromAnon-transgenicriceandB transgenic rice. The endosperm cells are filled with compound starchgranules circle. A In non-transgenic rice compound starch granules are tightly packed and some- times fused together. B In transgenic rice compound starch granules have spaces between each other. They are not fused together allowing us to distinguish the shape of each compound starch granule. Arrows indicate the spaces between compound starch granules. St indicates starch granules. Bars: 10 mm. Table 1 Differences in median flour particle size starch damage and apparent amylose content between non-transgenic rice and transgenic rice. Median particle size mm b Starch damage c Apparent amylose content d Non-transgenic rice 100.7 5.1 7.9 0.1 14.2 0.1 Transgenic rice 74.9 2.4 8.6 0.2 14.3 0.1 Difference a 25.8 0.7 0.1 Significantly different at 0.05 and 0.01 levels respectively t-test. a Difference between non-transgenic rice and transgenic rice. b Brown rice kernels were ground into flour in duplicate and particle size was calculated. c Starch damage was measured in duplicate and the values are averages of three independent experiments. d The analysis was repeated in triplicate. N. Wada et al. / Journal of Cereal Science 51 2010 182–188 186

slide 14:

SDS-PAGEinT 4 generationaswellasinT 2 generationasreportedby Wada et al. 2009. The results indicated that the A. tauschii authentic promoterof the Pinb gene can function in rice as aseed- specific promoter. The transgenic rice endosperm exhibited a loosely packed structure under SEM. The spaces between compound starch gran- uleswereobservedattheintercellularlycleavedsite.InwheatPINs havebeenreportedtolocalizeontheproteinmatrixandthesurface of starch granules. They prevent the adhesion between starch granules resulting in a softer grain texture Morris 2002. There- forethelooselypackedstructureinthetransgenicricemaysuggest that PINB also functions in rice in a similar way as in wheat pre- venting each compound starch granule from being packed tightly. However the intracellularly cleaved site exposing the polygonal starch granules showed no clear differences between non-trans- genic rice and the transgenic rice. PINs also influence the sizes of each starch granule in wheat. Studies of different types of wheat granules indicated that softer textured flours have larger granules than hard textured flours Gaines et al. 2000. In this study the morphology and size distribution of isolated starch granules in the transgenic rice were found to be not different from those of non-transgenic rice. The differences of the effect of PINB on the sizes and morphology of isolated starch granules can be explained by the developmental differencesbetweenriceandwheatendosperm.Inriceendosperm multiple polygonal granules develop within a single amyloplast. They are compressed together to form compound starch granules which have the appearance of a single granule. In wheat endo- sperm each granule develops within individual amyloplasts. This structural difference could give the difference in PINB localization providing the different effect on the isolated starch granules. TEM observation clearly supports the results of the SEM obser- vation.Theshapeofeachcompoundstarchgranulecouldeasilybe identified because theboundaryof compound starch granules was clear. This would be the effect of PINB on the surface of the compound starch granule preventing the adhesion within the compound starch granule. Thedifferenceofviscosityprofilealsocouldbeattributedtothe interaction of PINB with rice starch granules. The starch granule structure lipid and protein in rice endosperm have been reported toaffectthepastingpropertyHamakerandGriffin1993Xieetal. 2008. The apparent amylose content was not different between non-transgenic rice and the transgenic rice which indicates that the viscosity changes were not due to the change of apparent amylose content. Instead the decrease of peak viscosity in the transgenic rice might be due to the association of PINB with the surface of compound starch granules. PINB localized to the starch surface could inhibit the access of water to starch or swelling of starch which would lead to the decrease in viscosity during gela- tinization in the transgenic rice. The other well known characteristics of soft textured grain are the smaller flour particle size and less starch damage compared with hard textured grain Bhave and Morris 2008 Brites et al. 2008. The transgenic rice showed smaller median flour particle size than non-transgenic rice. However the starch damage was similar between the transgenic rice and non-transgenic rice. Usuallyflourswiththesmallerflourparticlesizehavehigherstarch damageunderthesamemillingconditionsSunetal.2007.Inthis study the difference of flour particle sizes was significant 25.8mm.Thereforeitcouldbepossible that PINBsuppressed the increase of starch damage in the transgenic rice otherwise the starch damage might be higher. The observed characteristics of the transgenic rice mentioned above suggest that 1 the expression of the PinB gene reduces the grainhardnessinjaponicariceand2PINBfunctionsatthesurface of compound starch granules not of polygonal starch granules in rice endosperm. The similar relationship between hardness and endosperm structure has been reported in wheat Xia et al. 2008 and barley Brennan et al. 1996. In wheat ‘‘knock-out’’ of PinA resulted in hardtextureinwhichthestarchgranuleshaverougherappearance withmoreproteinmatrixadheredtothesurfacethansofttextured wheat. In barley soft textured cultivars which show good malting quality have a lower degree of starch–protein binding than hard textured cultivars. Thus the observed relationship between hard- ness and endosperm structure is common in these three grains. Feiz et al. 2009 reported that PINs overexpression in wheat resulted in increased seed-bound polar lipids and hypothesized that PINs stabilize bound polar lipids on the surface of starch granule membranes preventing breakdown during seed desicca- tionandmaturation.Thepolarlipidsareconsideredtobefromthe ripened remnants of amyloplast. Thus it suggests that PINs have a role in maintaining the integrity of the amyloplast membranes. Our results support this hypothesis as the association of PINs with lipids derived from amyloplasts should occur on the surface of compound starch granules in rice. However further experiments such as immunostaining using anti-PINB antibody will be neces- sary to confirm the localization of PINB in rice endosperm. This is the first report that investigates the ultrastructure of endosperm and physicochemical properties of japonica rice expressing the PinB gene. Krishnamurthy and Giroux 2001 introduced the PinB gene into japonica rice cultivar M202 and observed differences in flour particle size distributions and starch damage.Comparingtheirworkwithourpresentstudydifferences intheresultscouldbeattributedtothedifferencesinthepromoter used or to the grinding method employed. In this study we used the A. tauschii PinB promoter while Krishnamurthy’s group used themaizeubiquitinpromotergivingadifferentexpressionlevelof PinB gene. Furthermore we applied a stronger grinding method thanthemethodtheyusedresulting insmallerflourparticlesizes and higher starch damage. ThejaponicaricemutantSuweon464Kimetal.2004awaxy rice variety Ibanez et al. 2007 and a brewer’s rice Tamaki et al. 2007 also have the spaces between starch granules as in the transgenic rice obtained in this study. However some properties such as the morphology of isolated starch granules ultrastructure of endosperm cells and viscosity profile during gelatinization are distinct to this transgenic rice we obtained. Thus the transgenic Table 2 Pasting properties of non-transgenic rice and the transgenic rice. Peakviscosity RVU Hot paste viscosity RVU Breakdown RVU Finalviscosity RVU SetbackRVU Peak time min Initialgelatinization temperature C Non-transgenicrice 392 16.2 154 10.4 237 6.8 267 7.1 113 3.6 6.3 0.0 66.7 0.48 Transgenic rice 319 10.0 125 4.1 194 6.0 232 4.7 107 0.63 6.3 0.0 66.4 0.076 Difference a 73 29 43 35 60 0.3 Pasting properties were measured in triplicate. Significantly different at 0.05 and 0.005 levels respectively t-test. a Difference between non-transgenic rice and the transgenic rice. N. Wada et al. / Journal of Cereal Science 51 2010 182–188 187

slide 15:

rice reported here has novel characteristics and could possess differentprocessingpropertiesfromthecultivatedricereportedso far.Thecreationofsuchvariationsinriceshouldmakeitpossibleto develop new end products and food uses. Furthermore the same strategy could be applied to manipulate the endosperm texture of other cereals. The softer texture and smaller flour particle sizes in cerealswouldhaveadvantagessuchassavingthemillingcostsand increasing the feed efficiency in cattle and broiler chickens Carre ´ et al. 2002 Swan et al. 2006a. The successful manipulation of endosperm texture of cereals could contribute numerous benefits to future agriculture. Acknowledgements A part of the present experiments was carried out by using a facility in the Research Center for Ultrahigh Voltage Electron Microscopy Osaka University. We are grateful to Mr. Noriaki Hasegawa Osaka University for technical support. We also thank Dr. Hitomi Yamada-Akiyama and Dr. Tadashi Takamizo National Institute of Livestock and Grassland Science for help with growth of the plants. The BAC 10 was kindly provided by Dr. S. Rahman CSIRO.ThisresearchwaspartiallysupportedbyaGrant-in-Aidfor Scientific Research B No. 19380194 from the Ministry of Education Culture Sports Science and Technology of Japan to Y.M and K.F. Wewouldalso like to express special thanks to the Global COE Center of Excellence Program ‘‘Global Education and Research Center for Bio-Environmental Chemistry’’ of Osaka University. N.W. was supported bya Research Fellowship from the Japanese Society for the Promotion of Science for Young Scientists. References Beecher B. Bettge A. Smidansky E. Giroux M.J. 2002. Expression of wild-type Pinbsequenceintransgenicwheatcomplementsahardphenotype.Theoretical and Applied Genetics 105 870–877. Bhave M. Morris C.F. 2008. Molecular genetics of puroindolines and related genes: allelic diversity in wheat and other grasses. Plant Molecular Biology 66 205–219. Brennan C.S. Harris N. Smith D. Shewry P.R.1996. Structural differences in the matureendospermsofgoodandpoormaltingbarleycultivars.JournalofCereal Science 24171–177. Brites C.M. dos Santos C.A.L. Bagulho A.S. Beirao-Da-Costa M.L. 2008. Effect of wheat puroindoline alleles on functional properties of starch. European Food Research and Technology 2261205–1212. Capparelli R. Borriello G. Giroux M.J. Amoroso M.G. 2003. Puroindoline A-gene expressionis involvedinassociation ofpuroindolinestostarch.Theoreticaland Applied Genetics 1071463–1468. Carre ´B. IdiA.Maisonnier S.Melcion J.P.Oury F.X. Gomez J. PluchardP.2002. Relationships between digestibilities of feed components and characteristics of wheats Triticum aestivum introduced as the only cereal source in a broiler chicken diet. British Poultry Science 43 404–415. CoronaV.GazzaL.BogginiG.PognaN.E.2001.Variationinfriabilincomposition as determined by A-PAGE fractionation and PCR amplification and its relation- shiptograinhardnessinbreadwheat.JournalofCerealScience34243–250. Feiz L. Wanjugi H. Melnyk C. Altosaar I. Martin J. Giroux M. 2009. Puroindo- lines co-localize to the starch granule surface and increase seed bound polar lipid content. Journal of Cereal Science 50 91–98. Fujita N. Kubo A. Suh D.S. Wong K.S. Jane J.L. Ozawa K. Takaiwa F. Inaba Y. Nakamura Y. 2003. Antisense inhibition of isoamylase alters the structure of amylopectin and the physicochemical properties of starch in rice endosperm. Plant and Cell Physiology 44 607–618. Gaines C.S. Raeker M.O. Tilley M. Finney P.L. Wilson J.D. Bechtel D.B. Martin R.J. Seib P.A. Lookhart G.L. Donelson T. 2000. Associations of starch gel hardness granule size waxy allelic expression thermal pasting milling quality and kernel texture of 12 soft wheat cultivars. Cereal Chemistry 77 163–168. Gautier M. Aleman M. Guirao A. Marion D. Joudrier P.1994. Triticum aestivum puroindolines two basic cystine-rich seed proteins: cDNA sequence analysis and developmental gene expression. Plant Molecular Biology 25 43–57. Greenwell P. Schofield J.D. 1986. A starch granule protein associated with endo- sperm softness in wheat. Cereal Chemistry 63 379–380. Hamaker B.R.Griffin V.K.1993.Effectofdisulfide bond-containing proteinonrice starch gelatinization and pasting. Cereal Chemistry 70 377–380. Hogg A.C. Sripo T. Beecher B. Martin J.M. Giroux M.J. 2004. Wheat puroindo- lines interact to form friabilin and control wheat grain hardness. Theoretical and Applied Genetics 1081089–1097. Ibanez A.M. Wood D.F. Yokoyama W.H. Park I.M. Tinoco M.A. Hudson C.A. McKenzie K.S. Shoemaker C.F. 2007. Viscoelastic properties of waxy and nonwaxyriceflours theirfatandprotein-freestarch andthemicrostructureof theircookedkernels.JournalofAgriculturalandFoodChemistry556761–6771. Juliano B.O.1971. A simplified assay for milled-rice amylose. Cereal Science Today 16 334–340. 360. Kim K.S. Kang H.J. Hwang I.K. Hwang H.G. Kim T.Y. Choi H.C. 2004. Compar- ative ultrastructure of Ilpumbyeo a high-quality japonica rice and its mutant Suweon464:scanningandtransmissionelectronmicroscopystudies.Journalof Agricultural and Food Chemistry 52 3876–3883. Krishnamurthy K. Giroux M.J. 2001. Expression of wheat puroindoline genes in transgenic rice enhances grain softness. Nature Biotechnology 19162–166. Law C. Young C. Brown J. Snape J. Worland A.1978. The study of grain protein control in wheat using whole chromosome substitution lines. In: Seed Protein Improvement by Nuclear Techniques. International Atomic Energy Agency Vienna Austria pp. 483–502. Marion D. Gautier M. Joudrier P. Ptak M. Pezolet M. Forest E. Clark D. Broekaert W.1994. Structure and function of wheat lipid binding proteins. In: Wheat Kernel Proteins Molecular and Functional Aspects. Universita Degli Studi della Tuscia Viterbo Italy pp.175–180. Martin J.M. Meyer F.D. Morris C.F. Giroux M.J. 2007. Pilot scale milling charac- teristics of transgenic isolines of a hard wheat over-expressing puroindolines. Crop Science 47 495–504. MartinJ.M.BeecherB.GirouxM.J.2008.Whitesaltednoodlecharacteristicsfrom transgenic isolines of wheat over expressing puroindolines. Journal of Cereal Science 48 800–807. Morris C.F. 2002. Puroindolines: the molecular genetic basis of wheat grain hardness. Plant Molecular Biology 48 633–647. Pomeranz Y. Williams P.C. 1990. Wheat hardness: its genetic structural and biochemicalbackgroundmeasurementandsignificance.In:PomeranzY.Ed. Advances in Cereal Science and Technology. American Association of Cereal Chemists Minnesota pp. 471–547. Rahman S. Jolly C.J. Skerritt J.H. Wallosheck A.1994. Cloning of a wheat 15-kDa grainsoftnessproteinGSP.GSPisamixtureofpuroindoline-likepolypeptides. European Journal of Biochemistry 223 917–925. Sun L.J. Zhou G.Y. Zhi G.A. Li Z.G. 2007. Effects of different milling methods on flour quality and performance in steamed breadmaking. Journal of Cereal Science 4518–23. Swan C.G. BowmanJ.G.P. MartinJ.M. GirouxM.J. 2006a. Increased puroindoline levels slow ruminal digestion of wheat Triticum aestivum L. starch by cattle. Journal of Animal Science 84 641–650. Swan C.G. Meyer F.D. Hogg A.C. Martin J.M. Giroux M.J. 2006b. Puroindoline B limits binding of puroindoline A to starch and grain softness. Crop Science 46 1656–1665. Tamaki M. Kurita S. Toyomaru M. Tsuchiya T. 2007. Hardness distribution and endosperm structure onpolishing characteristicsof brewer’s rice kernels. Plant Production Science 10 481–487. Wada N. Kajiyama S. Akiyama Y. Kawakami S. No D. Uchiyama S. Otani M. Shimada T. Nose N. Suzuki G. Mukai Y. Fukui K. 2009. Bioactive beads- mediated transformation of rice with large DNA fragments containing Aegilops tauschii genes. Plant Cell Reports 28 759–768. Wanjugi H. Hogg A. Martin J. Giroux M. 2007. The role of puroindoline A and B individuallyand in combination on grain hardness and starch association. Crop Science 47 67–76. Wiley P.R. Tosi P. Evrard A. Lovegrove A. Jones H.D. Shewry P.R. 2007. Promoter analysis and immunolocalisation show that puroindoline genes are exclusively expressed in starchy endosperm cells of wheat grain. Plant Molec- ular Biology 64125–136. Xia L. Geng H. Chen X. He Z. Lillemo M. Morris C.F. 2008. Silencing of pur- oindoline a alters the kernel texture in transgenic bread wheat. Journal of Cereal Science 47 331–338. Xie L.H. Chen N. Duan B.W. Zhu Z.W. Liao X.Y. 2008. Impact of proteins on pasting and cooking properties of waxy and non-waxy rice. Journal of Cereal Science 47 372–379. Yamamoto K. Sawada S. Onogaki T. 1981. Effects of quality and quantity of alkaline solution on the properties of the rice starch. Denpun Kagaku 28 241–244. N. Wada et al. / Journal of Cereal Science 51 2010 182–188 188

slide 16:

Prolamin a rice protein augments anti-leukaemia immune response Yu-Jen Chen a Yu-Yawn Chen b Chia-Tien Wu c Chih-Chia Yu c Hui-Fen Liao c a Department of Radiation Oncology Mackay Memorial Hospital Taipei 104 Taiwan b Department and Graduate School of Physical Education National Taiwan College of Physical Education Taichung 402 Taiwan c Department of Biochemical Science and Technology National Chiayi University Chiayi 600 Taiwan article info Article history: Received 4 August 2009 Accepted 13 November 2009 Keywords: Rice Prolamin Anti-leukaemia immunity abstract Rice Oryza sativa animportant cereal asa staple food worldwide can be used in gluten-free diets.This study aimed to isolate and characterize the active rice proteins and assess the anti-leukaemia response via in vitro and ex vivo experiments. Temperature-stable protein-containing extracts augmented this effect. Proteomic analysis identified various protein spots known with functions involving metabolism- related transport storage antioxidation development and disease-resistance proteins. Among these storage proteins were the most abundant. To avoid masking the other relatively scanty rice storage proteins albumin globulin glutelin and prolaminwereseparated and quantified. The humanperipheral blood mononuclear cells-conditioned medium PBMC-CM prepared from prolamin treatment showed an increment in production of tumor necrosis factor-a. Human leukaemia U937 cells cultured in the presence of prolamin-prepared PBMC-CM were inhibited in growth capacity and were triggered differentiation toward monocytes. Neutralization of prolamin by polyclonal antibody attenuated its activity. Rice prolamin undetectable by wheat gliadin-specific antibody has greater anti-leukaemia activity than wheat proteins glutenin and gliadin. In conclusion rice prolamin is effective in activating human anti-leukaemia immunity and may not induce unwanted inflammatory diseases. 2009 Elsevier Ltd. All rights reserved. 1. Introduction RiceOryzasativaprovides35–60ofcaloriesingestedbymany people especially in Asia Khush 1997. Rice is not only an importantcerealasa staplefoodworldwidebut isalsonutritional for human health with fewer allergenic properties and easier digestion Moro ´n et al. 2008. Several ingredients isolated and derived from rice possess various pharmacological and biological activities. For example a tocotrienol-rich fraction TRF25 of stabilized and heated rice bran is effective in lowering serum total and LDL-cholesterol levels in hypercholesterolaemic human subjectsQureshietal.2002.Fermentedbrownriceandricebran have chemopreventive potential in chemical-induced gastric oral oesophageal colonic and hepatic carcinogenesis Katayama et al. 2003 Kuno et al. 2004 Longet al.2007Tomita et al. 2008 and inhibitory effects in acute hepatitis Shibata et al. 2006 in rats. Using an experimental model of anti-leukaemia immunity we previously reported that water extracts of a rice cultivar Japonica rice milled Taiwan 9 MT9 stimulated cytokine release from mononuclear cells to inhibit growth and induce differentiation of human leukaemic cells Liao et al. 2006. Starch and protein are the two major components of rice Marshall and Wordsworth 1994. Rice seeds contain about 8–9 protein and contribute 28–54 of the protein in the Asian diet Duff1991. Four important fractions of rice proteins are identifi- able by differential solvent solubility. Of those rice seeds contain 5–10 alcohol-soluble proteins prolamin 4–10 salt-soluble proteinsglobulinandalbuminand80–90alkalisolubleproteins glutelin Cagampang et al.1966. Leukaemia is the most common malignancy in children Shi et al. 2009. Although chemotherapeutic agents have extensive achievements in the battle against leukaemia treatment-related toxicity remains an unsolved problem. The strategy of stimulating anti-leukaemia immune reactions through enhancing endogenous cytokine release is more tolerable especially when it comes from rice as a staple food eaten for more than one thousand years. To identify the bioactive ingredients responsible for the biological response modification effect of rice the present study isolated active components of rice and examined their effects on anti- leukaemia immunity. Abbreviations: BCA bicinchoninic acid CD celiac disease CHAPS 33- cholaminopropyl diethylammonio-1-propane sulfonate 2-DE two-dimensional electrophoresis FBS foetal bovine serum IFN-g interferon-gamma PBMC-CM mononuclear cell-conditioned medium MT9 Japonica rice milled Taiwan 9 SDS-PAGE sodium dodecyl sulphate–polyacrylamide gel electrophoresis SE stan- dard error TNF-a tumour necrosis factor-alpha. Corresponding author. Tel.:þ886 5 2717779 fax:þ886 5 2717929. E-mail address: liaohfseed.net.tw H.-F. Liao. Contents lists available at ScienceDirect Journal of Cereal Science journal homepage: www.elsevier.com/locate/jcs 0733-5210/ – see front matter 2009 Elsevier Ltd. All rights reserved. doi:10.1016/j.jcs.2009.11.011 Journal of Cereal Science 51 2010 189–197

slide 17:

2. Experimental 2.1. Materials and cells AriceO.sativaL.JaponicacultivarJaponicaricemilledTaiwan 9 MT9 was taxonomically characterized and kindly provided by specialists working at the Council of Agriculture Executive Yuan Taiwan. Wheat proteins glutenin and gliadinwere purchased from Sigma Chemical Company St. Louis MO USA. The human mono- blastoidleukaemiccelllineU937obtainedfromtheAmericanType CultureCollectionManassasVAUSAwasculturedinRPMI1640 medium containing 10 foetal calf serum FCS and maintained in an exponential growth state. 2.2. Isolation of peripheral blood mononuclear cells and preparation of conditioned medium HumanperipheralbloodmononuclearcellsPBMCsfromblood of healthy subjects were separated by centrifugation on a density gradient Ficoll-Hypaque 1.077 g/mL Pharmacia Fine Chemicals Wikstrams Sweden and incubated 1.5 10 6 cells/mL in RPMI 1640 medium Gibco Grand Island NY USA supplemented with 10heat-inactivatedfoetalbovineserumFBSHycloneLoganUT USA. PBMC-conditioned media PBMC-CM were prepared by incubating the cells with or without various rice extracts and rice proteinsat37 Cinahumidified5CO 2 incubatorfor24h.Thecell- freesupernatantswerethencollectedfilteredandstoredat 70 C until required. The PBMC-CM collected from extract-treated and untreatedPBMCculturesweredesignatedasextract-PBMC-CMand normal PBMC-CM respectively. PhytohemagglutininP PHA10mg/ml Difco Laboratories Detroit MI USA was used to prepare PHA– PBMC-CM as described above that served as the positive control. Endotoxin is known to activate monocyte–macrophage lineage whichmaycontributetoaconsiderableeffectofPBMCsinouranti- leukaemia immunity model. To rule out possible endotoxin contaminationofthericeextractstheconditionedmediafromrice- stimulated PBMCs were prepared in the presence of 50 mg/mL polymyxinBSigmainsomeexperimentsofgrowthinhibitionand differentiationofleukaemiccells.Inadditiontumornecrosisfactor TNF-a contained in PBMC-CMs made by rice-stimulation as an estimation of secreted TNF-a by PBMC was measured byenzyme- linkedimmunoassayEIARDSystemsMinneapolisMNUSA. 2.3. Anti-leukaemia immunity assay For the in vitro anti-leukaemia immunity assay the growth inhibition and differentiation induction of U937 cells were assessed. First the cells were incubated in 35-mm Petri-dishes at densities of 10 5 cells/mL in the presence of various concentrations oftheextracts30v/vofextract-PBMC-CMornormalPBMC-CM for 5 days. Then the cells were collected by gently rubbing the dishes with a rubber policeman Bellco Glass Vineland NJ USA and growth inhibition was assessed using the trypan blue dye exclusion test. Cell morphology was evaluated by cytocen- trifugation onto a microscope slide using the Cytospin 2 Shandon Southern Instrument Pittsburgh PA stained with Wright’s stain Sigma and observed under an inverted microscope Olympus Melville NY USA for determining monocyte differential counts. 2.4. Preparation of rice extracts Rice extracts were prepared bygrinding 1 g of rice bran endo- sperm and total rice seeds into a powder then extracting with 50 mL of hot boiled or cold 20 C H 2 O with stirring for 30 min and collecting the extracts by filtration. The rice extracts were treated with or without protease K 50 mg/mL Sigma at 37 C for 2 h then the enzyme was inactivated by boiling for 30 min. The treatments without enzyme groups were also boiled for 30 min. SampleswerefrozenanddriedinalyophilizerTokyoRikakikaiCo. Tokyo Japan and the recovery weights were assessed. The rice extracts were then used to treat the PBMCs at final concentrations of100mg/mLand500mg/mLtoevaluatetheiranti-leukaemiceffect. 2.5. Two-dimensional electrophoresis of rice proteins Ricebranandendospermsamplesweregroundintopowderand dissolvedinlysisbuffer8Murea4CHAPSat4 C.Theinsoluble fractionwasremovedbycentrifugation16000g18 C20minand A e t a r n o i t i b i h n I 0 5 10 15 20 25 Untreatment Protease K treatment Treatment of PBMC-CMs Total rice-ext Endosperm-ext Bran-ext 100 g/mL 100 g/mL 100 g/mL B Treatment of PBMC-CMs e t a r n o i t i b i h n I 0 20 40 60 80 Co t n l o r P A H 2 0L m / g H t o H 2 t x e - O 0 0 1 L m / g H t o H 2 t x e - O 0 0 5 L m / g H d l o C 2 x e - O t 5 00m / g L μ μ μ μ μμ μ Fig.1. Growth inhibition of U937 cells with treatmentof 30 rice extract- and normal PBMC-CM for 5 days. A PBMC-CM collected from PBMCs treated with total rice endosperm and bran-extracts of MT9 rice with or without protease K treatment. B PBMC-CM collected from PBMCs treated with hot and cold H 2 O-extracts of MT9 endosperm. Rice samples were extracted with and without deproteinisation with protease K 50 mg/mL for 2 h. All PBMCs were treated with rice extracts for 24 h and the cell-free supernatants PBMC-CM were collected for assay of the rice extract inhibitory effect on leukaemia U937 cells. PHA 20 mg/mL was used as the positive control. All values are shown as the mean SEM for at least three independent experiments. Differences are considered significant at p 0.05. Y.-J. Chen et al. / Journal of Cereal Science 51 2010 189–197 190

slide 18:

the total protein was collected and quantified using the bicincho- ninicacidBCAproteinassaykitSigma.A100-mgproteinsample was solubilised in 50 mM dithiothreitol1 w/v IPG buffer Bio- Lyte pH 3–10 ampholyte Bio-Rad Hercules CA and rehydration buffer 9 M urea 4 CHAPS and bromophenol blue and absorbed into a ReadyStrip IPG strip 17 cm pH 3–10 Bio-Rad for 24 h at roomtemperature.Fortheseconddimensionthestripwassoaked inequilibrationbuffer6Murea30glycerol50mMTris–HClpH A Endosperm Bran 11 11 12 12 1 1 2 2 3 3 4 4 13 13 14 14 6 6 9 9 MW kDa pI 5 5 6 6 7 7 8 8 9 9 10 10 14 14 13 13 1 1 pI 6 106 11 11 12 12 1 1 2 2 3 3 4 4 13 13 14 14 6 6 9 9 11 11 12 12 1 1 2 2 3 3 4 4 13 13 14 14 6 6 9 9 MW kDa pI 5 5 6 6 7 7 8 8 9 9 10 10 14 14 13 13 1 1 5 5 6 6 7 7 8 8 9 9 10 10 14 14 13 13 1 1 pI 6 106 B Bran Endosperm 9 9 10 10 12 12 4 4 9 9 5 5 6 6 7 7 8 8 14 14 13 13 1 1 11 11 1 1 2 2 3 3 13 13 14 14 6 6 Bran Endosperm 9 9 10 10 9 9 10 10 12 12 4 4 9 9 12 12 4 4 9 9 5 5 6 6 7 7 8 8 14 14 13 13 1 1 5 5 6 6 7 7 8 8 14 14 13 13 1 1 11 11 1 1 2 2 3 3 13 13 14 14 6 6 11 11 1 1 2 2 3 3 13 13 14 14 6 6 Fig.2. AnalysisofendospermandbranproteinextractsofMT9riceusing2-DE.ARepresentative2-DEgelimageforriceendospermandbranproteins.BThedetailedpatternsof each identified protein spot.Totalproteins were extractedfromrice endosperm and branbydissolution in lysis buffer 8 M urea4 CHAPS at 4 C 100mgof proteinpergelwere applied for 2-DE analysis. The gels were visualized by using a zinc staining kit. Y.-J. Chen et al. / Journal of Cereal Science 51 2010 189–197 191

slide 19:

8.8 2 SDS and 0.01 bromophenol blue containing 2 iodoace- tamidefor15minandappliedto12.5SDS-polyacrylamidegelsfor electrophoresis.Thenthegelwasfixedwithfixationsolution40 methanol and 10 acetic acid stained with a zinc staining kit VisPRO protein stain kit Visual Protein Biotech. Taipei Taiwan scanned using an ImageScanner densitometer and analyzed using Z3softwareVersion 2.00 CompugenLtd. JamesburgNJ. 2.6. In-gel digestion and MALDI-TOF mass analysis Protein spots were excised destained with 10 acetic acid for 5 min and washed with deionized H 2 O three times. The samples were soaked in 50 mM ammonium bicarbonate:acetonitrile 3:2 Sigmafor15min.Thisprocedurewasrepeatedthreetimes.Then disulfidebondsweresubjectedtoreductionwith200mLofa10mM Table 1 Protein identification by mass spectrometry and database search. a Classification No. Protein names/Acc. No. pI MW. Score Endosperm/Bran Metabolism-related proteins 1–1 Dihydropteroate synthase DHPS/46906457 9.02 39454 91 229.8 3 3-Phosphoshikimate 1-carboxyvinyltransferase/AROA_BACCR 5.40 45287 72 Bran only 4–1 Chemotaxis protein methyltransferase 2/CHER2_VIBCH 6.62 33610 50 Bran only 5 Malate dehydrogenase cytoplasmic/MDHC_BETVU 5.89 35411 40 Endosperm only 9–1 CoA-binding domain protein/219668628 5.66 14597 56 150.6 Transport proteins 7 Response regulator receiver/163849690 6.42 27367 54 Endosperm only 9–2 Probable calcium-binding protein CML7/CML7_ORYSJ 4.89 16672 44 150.6 10–1 Trigger factor/TIG_MAGSM 4.68 49283 59 Endosperm only 14–1 Guanine nucleotide- binding protein Gq subunit alpha/GNAO_HUMAN 5.58 41441 43 59.8 Storge proteins 1–2 Glutelin/31455453 6.60 35639 49 229.8 6–1 Glutelin type I precursor/GLUA1_ORYSJ 9.09 56212 108 118.6 6–2 Glutelin II precursor/A34332 8.93 56271 74 118.6 6–3 Glutelin precursor/A27033 9.17 56274 90 118.6 6–4 Glutelin/169791 9.17 55879 108 118.6 8 Glutelin/31455453 6.60 35639 64 Endosperm only Antioxidant-related proteins 2–1 1-Cys peroxiredoxin A/REHYA_ORYSJ 5.97 24027 91 Bran only 2–2 RAB24 protein/T03967 5.87 24127 76 Bran only 4–2 Os07g0638300/115473617 5.97 24027 70 Bran only 11 Ferredoxin-thioredoxin reductase catalytic chain chloroplastic/FTRC_MAIZE 8.61 16729 50 Bran only 13 Putative oxidoreductase/146337297 5.90 30720 55 57.5 Development protein 10–2 Putative synovial sarcoma X breakpoint 2 interacting protein/Q6Z0V1_ORYSA 7.08 44567 61 Endosperm only Disease-resistance protein 12–1 NBS-LRR-like protein CR372/Q7Y063_ORYSA 6.34 20782 59 Bran only Unknown proteins 12–2 Hypothetical protein OsI_12089/218193065 5.32 20459 61 Bran only 14–2 Hypothetical protein T08B1.4/193208661 6.95 38464 49 59.8 a Totalproteinsfromriceendospermandbranwereextractedfor2-dimentionalelectrophoresis.Theproteinspotswereexcisedappliedtoin-geldigestionandanalysisby mass spectrometry. A B mean Treatment of PBMC-CMs e t a r n o i t i b i h n I 0 10 20 30 40 50 60 70 n E dosperm-e t x l A bumin Globulin Glutelin Prolamin PHA DMSO control P S B control Precipitation MT9 rice endosperm samples H 2 O extract at room temperature by shaking for 4 h centrifuged at 3000 g 30 min Defat with hexane for 24 h then air-dry Supernatant Albumin 2 times Precipitation 5 NaCl salt extract by shaking for 4 h centrifuged at 3000 g 30 min Supernatant Globulin 2 times Precipitation 0.02 M NaOH alkali extract pH11 by shaking for 4 h centrifuged at 3000 g 30 min Supernatant Glutelin 2 times Precipitation starch-rich 70 alcohol extract by shaking for 4 h centrifuged at 3000 g 30 min Supernatant Prolamin 2 times Fig.3. IsolationandanalysisofMT9ricestorageproteins.AIsolationproceduresofriceproteinsalbuminglobulinglutelinandprolamin.BGrowthinhibitionofU937cellsupon treatment with 30 rice protein 100 mg/ml-PBMC-CM for 5 days. C Cell morphology and monocyte differentiation counting. D Level of TNF-a. Storage proteins were isolated from rice endosperm. The PBMCs were treated with the rice endosperm extracts for 24 h and the PBMC-CM were collected for assay of growth inhibition and differentiation inducing effects on leukaemia U937 cells. All values are shown as means SEMs for at least three independent experiments. Differences are considered significant at p 0.05 compared to the untreated control. Y.-J. Chen et al. / Journal of Cereal Science 51 2010 189–197 192

slide 20:

dithiothreitol solution in 25 mM ammonium bicarbonate Sigma at56 Cfor45minandalkylationwith200mLofaniodoacetamide solution in 25 mM ammonium bicarbonate at room temperature for30mininthedark.Thesampleswerewashedagainwith50mM ammonium bicarbonate:acetonitrile 3:2 and dried in a vacuum centrifuge. For in-gel digestion the protein gels were mixed with 5 mL of trypsin 4 mg/mL Sigma and ammonium bicarbonate 10mMandincubatedovernightat37 C.Peptideswereextracted from the gel three times with 3 mL of 50 acetonitrile and 1 tri- fluoroacetic acid by sonication for 10 min each. The supernatants were combined dried in a vacuum centrifuge and used for mass spectrometry MALDI-QUAD-TOF analysis Core Facilities for Pro- teomics and Structural Biology Research Academia Sinica Taipei Taiwan. Mass spectra data were submitted to database searches using the Mascot program http://www.matrixscience.com. 2.7. Isolation of rice storage proteins Rice proteins albumin globulin glutelin and prolamin can be effectively extracted by using appropriate solvents as previously μ μ μ Control PHA20 μg/mL Prolamin 100 μg/mL Treatment of PBMC-CMs n o i t a i t n e r e f f i d e t y c o n o M 0 20 40 60 80 100 Control PHA 20 g/mL Exdosperm-ext 500 g/mL Prolamin 100 g/mL Treatment of PBMC-CMs - F N T f o l e v e L α α L m / g p 0 500 1000 1500 2000 2500 3000 Control PHA 20 μg/mL - erm μ Exdosp ext 500 g/mL μ Prolamin 100 g m / L C D Fig. 3. continued. Y.-J. Chen et al. / Journal of Cereal Science 51 2010 189–197 193

slide 21:

reported Ju et al. 2001. Briefly rice endosperm 10 g was defattedwith40mlhexane.Thedefattedriceflourwasdriedunder a hood at ambient temperature for 24 h. The flour was then extracted by shaking with 40 mL of distilled water at room temperaturefor4halbuminextractandcentrifugingat3000gfor 30 min. After waterextraction the flour was extractedwith 40 mL of 5 NaCl for 4 h globulin extract and centrifuged at 3000g for 30 min. The flour was then extracted for glutelin with 30 mL of 0.02 M NaOH to pH 11.0 for 4 h and centrifuged at 3000g for 30minthiswasfollowedbyprolaminextractionwith30mLof70 ethanol for further 4 h. Each extractionwas repeated two times at room temperature in order to remove all the proteins of each fraction and then the extracts were freeze dried in the lyophilizer. 2.8. Preparation of anti-prolamin antibody and antibody neutralization Anti-prolamin antibody was prepared by Blossom Biotech- nology Inc. Poway CA. In brief the isolated prolamin was sub- jected to SDS-PAGE and the gel was stained with Coomassie brilliant blue R250 Sigma. Prolamin protein about 15 kDa was excised from the gel and collected for immunization. Pre-immune serawerecollectedfromtwoNewZealandwhiterabbitsthatwere theninjectedsubcutaneouslywith200mg/500mLofprolaminwith complete Freund’s adjuvant CFA for 2 weeks followed by subcutaneous immunization three times by injection of 100 mg/ 500 mL prolaminwith incomplete Freund’s adjuvant IFA every 2 weeksfor2months.Twoweeksafterthelastimmunizationblood sampleswerecollectedfromtherabbitsandtheimmuneserawere collectedbycentrifugation.Theanti-prolaminantibodytiterswere evaluated against prolamin protein by ELISA after the last immunization. Fortheantibodyneutralizationassayriceextractsandprolamin were treated with or without anti-prolamin antibody 1:100 at 37 C for 2 h. The supernatants were collected bycentrifugation at 14000 g for 10 min. The supernatants were then used to treat PBMCsintheanti-leukaemiaimmunityassayasdescribedabovein Section 2.3. 2.9. SDS-PAGE and western blot analysis Rice samples were lysed in lysis buffer 8 M urea 4 CHAPS at 4 C and disrupted with 2 concentrated electrophoresis sample buffer1MTrispH6.85SDS40glycerol0.005bromophenol blue and 8 b-mercaptoethanol. The protein samples were collected by centrifugation and protein was quantified using the BCA method Sigma. Equal concentrations of each protein sample wereappliedto10w/vSDS-polyacrylamidegelsandsubjectedto electrophoresis and then blotted on a PVDF membrane. Primary antibodies including anti-prolamin 1:500 from this study and anti-gliadin1:500SantaCruzBiotech.HeidelbergGermanywere hybridized for 2 h and reacted with horseradish peroxidase- conjugatedanti-rabbitimmunoglobulinIgGIgG1:1000Sigma and anti-mouse IgG 1:1000 Sigma respectively for another 2 h. Targetproteinswerevisualizedusinganelectrochemiluminescence ECL kit Amersham Pharmacia in a chemiluminescence imaging systemPerkin Elmer WalthamMA USA. 2.10. Statistical analysis Resultswereexpressedasmeans standarderrorsSEsfromat leastthreeindependentexperiments.Statisticalcomparisonswere performed using Student’s t-test as appropriate. Differences were considered significant at p 0.05. 3. Results 3.1. Protein-containing rice-extract promotes anti-leukaemia reactions Water extracts of rice from whole grain endosperm and bran exhibited PBMC-stimulating activity against the growth of human leukaemic U937 cells Fig. 1A. No extract had any direct growth inhibitoryeffectonU937cellsdatanotshownindicatingindirect anti-leukaemia activity through interaction with PBMCs. Of the extracts endosperm extract possessed greater activity than bran extract. Addition of protease K to all extracts markedly reduced their activity against leukaemia cells indicating that proteins con- tainedinextractsmightbethemajorresponsiblecomponents.Rice endospermextractwasresistanttopre-treatmenthot100 Cand cold 20 C stress for 30 min in the temperature sensitivity assessments Fig.1B. Addition of polymyxin B in to PBMC-CM did not affect the effect of PBMC-CM prepared from rice extracts suggestingnoorscantyendotoxincontaminationdatanotshown. 3.2. 2-DE and MALDI-TOF mass spectrometry and bioactivity of prolamin in rice extract To characterize the active proteins contained in the rice endo- sperm extract 2-DE followed by mass spectrometry was per- formed.The major protein spots identified on 2-DEincluded those with known functions involving metabolism transport storage antioxidation development and disease resistance Fig. 2 and Table 1. The most commonly identified and abundant proteins werestorageproteins.Giventhatthegreatamountofglutelincould mask the existence of relatively scanty amounts of other storage proteins we next separately quantified other known storage proteins including albumin globulin glutelin and prolamin in the rice extracts Fig. 3A. Of these storage proteins prolamin was the least abundant The yield of prolamin is approximately 11.8 2.9 mg/g rice endosperm and most effective component in terms of growth inhibition of U937 leukaemia cells modulated throughPBMCactivationFig.3B.Additionallyprolamin-prepared PBMC-CM promoted monocyte differentiation of U937 cells Fig.3C.TheamountofTNF-asecretedintoPBMC-CMsignificantly increased with prolamin treatment Fig. 3D. 3.3. Protein responsible for the effects of rice extracts Toprovideevidencethatprolaminplayedaroleintheactivities ofthericeextractswepurifiedprolaminfromMT9riceandusedit to produce polyclonal antibodies for further experiments. The detectionabilityandspecificityofthisantibodywasvalidatedusing SDS-PAGE and Western blotting Fig. 4A. Intriguingly antibody neutralization experiments show that the anti-leukaemia immune reaction elicited by rice extract endosperm extract and prolamin was partially blocked Fig. 4B suggesting that prolamin is one of the main proteins responsible for the anti-leukaemia immune effect of the rice extracts. 3.4. Prolamin isolated from rice is distinct to gluten proteins from wheat Wheat gluten proteins including glutenin and gliadin are known inducers of celiac disease. To determine whether rice prolamin shared this distinct property with wheat gluten we performedbioactivityandantibodycompatibilityassays.PBMC-CM prepared from rice prolamin inhibited the growth of leukaemia U937 cells to an extent greater than wheat glutelin and gliadin Fig.5A.Moreoverantibodiesagainstwheatgliadinonlydetected Y.-J. Chen et al. / Journal of Cereal Science 51 2010 189–197 194

slide 22:

wheat glutenin and gliadin and did not cross react with rice extracts and proteins Fig. 5B. 4. Discussion ProlaminthebioactivecomponentofMT9riceidentifiedinthis study stimulated cytokine release from normal PBMCs to inhibit growth and induce differentiation of human leukaemic U937 cells. The digestion of prolamin by gastrointestinal enzymes is indeed possible to avoid its contact with leukocytes. To clarify this point bothinvitroenzyme-digestedproductsofprolaminKimandOkita 1988 for the same model used in this work and in vivo oral administrationanimalmodeltoverifythebioactivitynotedinthein vitro study were conducted. Furthermore by using LPS antagonist polymyxin B we excluded the contamination of LPS in PBMC-CM prepared from rice extracts. Endotoxin is known to activate mono- cyte–macrophage lineage Yamazaki et al. 2008 which may contribute to a considerable effect of PBMCs in our anti-leukaemia immunity model. Growing evidence shows that ingestion of cereal grainsmodulatesimmunereactionsbystimulatingthegastrointes- tinalimmunesystemandinducingproductionofIL-10fromCD14 þ monocytes in vitro Yamazaki et al. 2008 and improving mouse leukocyte parameters including chemotaxis capacity microbicidal activity lymphoproliferation and cytokine release Alvarez et al. 2006. Previous research also demonstrated that the growth of human leukaemic U937 cells was significantly inhibited by periph- eral blood PBMC-CM derived fromwater extracts of MT9 rice Liao etal.2006.Thiseffectmightbemediatedthroughthesecretionof TNF-a and IFN-g in PBMC-CM prepared with MT9 rice Liao et al. 2006. We demonstrated that a temperature-stable protein prolamin in MT9 rice endosperm is the major active component responsible for immune modulation of PBMCs via conditioned media. Prolamin-treated PBMCs not only inhibited the growth of U937cellsbutalsoinducedtheU937cellstowardmonocyticdiffer- entiationasshownbymorphologicalobservationsandTNF-aproduction. Taken together characterization of a temperature-stable biological response modifier from rice may help people to promote anti- leukaemia immunity. Initially we used differential temperatures to characterize the physical properties of active rice extracts. The active rice extracts are resistant to high and low temperatures indicating consistency between cooked and cold-stored rice in dailylife Fig.1. Then we subjected these active extracts to 2-DE and mass spectrometry in the proteomic analysis. The major identified proteinspots on 2-DE included those with known functions involving metabolism transport storage antioxidation development and disease resis- tance. Among these the most abundant protein is the storage proteins. Although glutelin was the major protein found on 2-DE we postulate that some minor components of rice storage protein might be masked on 2-DE due to their relatively small quantities. Villareal and Juliano 1977 reported that only 5–10 of prolamin typeIproteinbodyarecontainedinthetotalendospermproteins while the content of glutelin type II protein body was up to 80. Thus weisolated fourknown storageproteins fromrice including albumin globulin glutelin and prolamin Ju et al. 2001 and subjected them to anti-leukaemia immunity assays. Prolamin the leastabundantpossessedthegreatestactivity.Prolaminisaminor storage protein in many cereal grains with its characteristic solu- bility in alcohol–water solutions and resistance to autoclaving and proteolysis by pepsin Kim and Okita1988. Given that the active component of rice extract is heat-resistant we suggest that prolamin might be the active component of rice in terms of stim- ulating anti-leukaemia immune reactions. Few articles report the bioactivity of rice proteins one example is Yang et al. 2007 who reported that Japonica rice cultivars with low glutelin and high prolamincontenthavecholesterolandtriglyceride-loweringeffects in rats. We identified rice prolamin as an active rice ingredient capable of activating anti-leukaemia immunity. Inadditionthemajorcomponentofprolaminisolatedfromrice endosperm ranged from 10 to 17 kDa Yamagata et al.1992. Kim and Okita 1988 reported that the encoded protein of prolamin precursor was 17.3 kDa. After cleavage of the signal peptide the deduced mature prolamin was 15.4 kDa and possessed a high percentage of glutamine proline and aromatic amino acids and relativelylowlevelsofchargedresiduesKimandOkita1988.Our results showed a similar molecular weight for prolamin about 15 kDa by SDS-PAGE and Western blot analysis. To further verify the role of prolamin we prepared polyclonal antibody against prolamin and found it partially blocked the activity of both prolamin and rice extracts. The growth inhibition A B Treatment of PBMC-CMs e t a r n o i t i b i h n I 0 10 20 30 40 50 without Ab with Ab 1:100 Total rice-ext Endosperm-ext Prolamin 500 g/mL 500 g/mL 100 g/mL MW kDa 10 17 26 CBR stain: WB: anti-prolamin μ μ μ Fig. 4. Analysis of prolamin. A SDS-PAGE and Western blot analysis of prolamin isolates. B Growth inhibition of U937 cells upon treatment with rice extracts and prolamin-PBMC-CM with and without anti-prolamin antibody 1:100 neutralization. The prolaminwas isolated from MT9 rice endosperm and anti-prolamin antibody was prepared for western blotting analysis and anti-leukaemia immunity by antibody neutralization. All values are shown as means SEMs for at least three independent experiments. Differences are considered significant at p 0.05. Y.-J. Chen et al. / Journal of Cereal Science 51 2010 189–197 195

slide 23:

effects of rice extracts and isolated prolamin were markedly decreased by anti-prolamin antibody neutralization Fig. 4. Thus prolamin is the key protein responsible for activation of in vitro anti-leukaemia immunity. Unlike rice proteins gluten such as glutenin and gliadin in wheatandsimilaralcohol-solubleproteinsprolaminsinbarleyand ryearesusceptiblesubjectstotriggerCDFasanoandCatassi2001. CDisanimmune-mediatedenteropathycausedbyglutenpeptides especiallyinits33-merpeptidefroma-2gliadinShanetal.2002it leads to the destruction of the digestive enzymes in the small intestineSollid2002.Almost1oftheworld’spopulationwhoeat gluten-containingdietscouldsufferfromCDLeeandGreen2006. Moro ´n et al. 2008 designed monoclonal antibodies against the gliadin 33-mer peptide to detect the toxic peptide in foods demonstrating that samples containing prolamin from rice and maizearegluten-freefoodstuffsandnontoxictoCDpatients.Wealso demonstratedthatriceprolaminhasgreateranti-leukaemiaactivity than wheat proteins glutenin and gliadin Fig. 5. These storage Treatment of PBMC-CMs e t a r n o i t i b i h n I 0 10 20 30 40 50 60 70 i R e c P / o r lamin 1 00 g L m / Wheat/Gliadin g/mL H P A 2 0 L m / g DMS o c O n o r t l l o r t n o c S B P Wheat/Glutenin g/mL 100 200 100 200 Anti-gliadin Ab. 72 55 43 34 26 17 95 130 170 MW kDa l G iadin Glutenin Bran-ext. Endosperm -ext. Wheat Rice Gliadin G u l ten n i Wheat Rice G u l te n i l G o l bu i l n Pro a l m n i Ab l um n i 72 55 43 34 26 17 95 130 170 MW kDa l G iadin Glutenin Bran-ext. Endosperm -ext. Wheat Rice Gliadin G u l ten n i Wheat Rice G u l te n i l G o l bu i l n Pro a l m n i Ab l um n i A B μ μ μ μ Fig.5. Comparisonofriceandwheatproteins.AGrowthinhibitionofU937cellsupontreatmentwithriceandwheatprotein-PBMC-CM30for5days.BWesternblotanalysis of rice and wheat proteins with hybridization of anti-gliadin antibodies. PBMCs were treated with rice prolamin and wheat proteins glutenin and gliadin for 24 h. The cell-free PBMC-CMwerecollectedandusedtotreattheleukaemiaU937cellstoassaygrowthinhibitionrates.InadditionWesternblotanalyseswereperformedtoassesscross-reactionsof anti-gliadinantibodywithriceandwheatproteins.Allvaluesareshownasthemeans SEMsforatleastthreeindependentexperiments.Differencesareconsideredsignificantat p 0.05 compared to the untreated control. Y.-J. Chen et al. / Journal of Cereal Science 51 2010 189–197 196

slide 24:

proteins are highly homologous among the different grain species. Forexamplericeprolaminisstructurallyhomologouswithprolamin from wheat and barley Kikuchi et al.1987 rice glutelin is highly homologousinaminoacidsequencewiththe11Sglobulinfromthe legume protein legumin Rout and Chrungoo1996 and rice glob- ulin is structurally similar to wheat glutenin Komatsu and Hirano 1992. However Krishnan and Okita 1986 also indicated that the prolamin antibody exhibited high specificity and had no cross- reaction with other polypeptides. Hernando et al. 2003 reported that the ethanol-soluble wheat gliadin can be quantitatively solu- bilisedin1.0Maceticacidwhilethecorrespondingethanol-soluble maize and rice prolamin remain insoluble in acetic acid. In our Western blotting results the anti-gliadin antibodies only cross- linked with wheat proteins but not rice extracts and proteins. This suggests that gluten-free rice possesses significant anti-leukaemia immunity by its prolamin content and might not induce CD. Given that a lifelong gluten-free diet is an important way to avoid CD Schuppan and Hahn 2002 rice prolamin might be a good candi- dateforfoodsubstitutionamongCDpatients. The yield of prolamin in our tested rice is approximately 11.8 2.9 mg/g endosperm. Screening by using the in vitro/ex vivo modelwedemonstratedabioactiveproteinprolaminfromricemay have potential to potentiate anti-leukaemia immunity. To test its actualeffectinvivooraladministrationofriceextractsorprolaminto experimental animals to examine the anti-leukaemia activity kineticsofmetabolismandpossibletoxicityforsafetyconsideration should be performed in the continuing research. In conclusion we isolated rice proteins and established a proteomic approach for detectingdifferentiallyexpressedproteins.Theresultsdemonstrated that temperature-stable prolamin in rice endosperm had a marked beneficialeffectonactivatinganti-leukaemiaimmunity. Acknowledgements This study was supported by grant No. 98AS-4.2.1-FD-Z5 from the Council of Agriculture Executive Yuan Taiwan ROC. References Alvarez P. Alvarado C. Mathieu F. Jime ´nez L. De la Fuente M. 2006. Diet supplementation for 5 weeks with polyphenol-rich cereals improves several functions and the redox state of mouse leucocytes. Eur. J. Nutr 45 8 428–438. Cagampang G.B. Cruz L.J. Espiritu S.G. Santiago R.G. Juliano B.O.1966. Studies on the extraction and composition of rice proteins. Cereal Chem 43145–155. Duff B. 1991. Marketing and Quality Issues. International Rice Research Institute Los Banos Philippines pp.1–22. FasanoA.CatassiC.2001.Currentapproachestodiagnosisandtreatmentofceliac disease: an evolving spectrum. Gastroenterology 120 3 636–651. Hernando A. Israel V. Mendez E. 2003. New strategy for the determination of gliadins in maize- or rice-based foods matrix-assisted laser desorption/ioniza- tion time-of-flight mass spectrometry: fractionation of gliadins from maize or rice prolamins by acidic treatment. J. Mass. Spectrom 38 8 862–871. Ju Z.Y. Hettiarachchy N.S. Rath N. 2001. Extraction denaturation and hydro- phobic properties of rice flour proteins. J. Food. Sci 66 2 229–232. Katayama M. Sugie S. Yoshimi N. Yamada Y. Sakata K. Qiao Z. Iwasaki T. KobayashiH.MoriH.2003.Preventiveeffectoffermentedbrownriceandrice bran on diethylnitrosoamine and phenobarbital-induced hepatocarcinogenesis in male F344 rats. Oncol. Rep 10 4 875–880. Khush G.S.1997. Origin dispersal cultivation and variation of rice. Plant. Mol. Biol 35 1–2 25–34. KikuchiS.TakaiwaF.OonoK.1987.VariablecopynumberDNAsequencesinrice. Mol. Gen. Genet 210 3 373–380. Kim W.T. Okita T.W. 1988. Nucleotide and primary sequence of a major rice prolamine. FEBS. Lett 231 2 308–310. Komatsu S. Hirano H. 1992. Rice seed globulin: a protein similar to wheat seed glutenin. Phytochemistry 31 10 3455–3459. Krishnan H.B. Okita T.W. 1986. Structural relationship among the rice glutelin polypeptides. Plant. Physiol 81 3 748–753. Kuno T. Hirose Y. Hata K. Kato K. Qiang S.H. Kitaori N. Hara A. Iwasaki T. Yoshimura T. Wada K. Kobayashi H. Mori H. 2004. Preventive effect of fer- mented brown rice and rice bran on N-nitrosomethylbenzylamine-induced esophageal tumorigenesis in rats. Int. J. Oncol 25 61809–1815. Lee S.K. Green P.H.R. 2006. Celiac sprue the great modern-day imposter. Curr. Opin. Rheumatol 18 1101–107. Liao H.F. Chen Y.Y. Yang Y.C. Wang C.S. Chen Y.J. 2006. Rice Oryza sativa L. inhibits growth and induces differentiation of human leukemic U937 cells through activation of peripheral blood mononuclear cells. Food. Chem. Toxicol 44 101724–1729. Long N.K. Makita H. Yamashita T. Toida M. Kato K. Hatakeyama D. Shibata T. 2007. Chemopreventive effect of fermented brown rice and rice bran on 4-nitroquinoline 1-oxide-induced oral carcinogenesis in rats. Oncol. Rep 17 4 879–885. Marshall W.G. Wordsworth J.I.1994. Rice Science and Technology. Marcel Dekker Inc. New York pp. 237–259. Moro ´n B. Cebolla A. Manyani H. A ´ lvarez-Maqueda M. Megı ´as M. Thomas MdelC.Lo ´pezM.C.SousaC.2008.Sensitivedetectionof cerealfractionsthat are toxic to celiac disease patients by using monoclonal antibodies to a main immunogenic wheat peptide. Am. J. Clin. Nutr 87 2 405–414. QureshiA.A.SamiS.A.SalserW.A.KhanF.A.2002.Dose-dependentsuppression of serum cholesterol by tocotrienol-rich fraction TRF25 of rice bran in hypercholesterolemic humans. Atherosclerosis 161 1199–207. Rout M.K. Chrungoo N.K.1996. Partial characterization of the lysine rich 280 kD globulin from common buckwheat Fagopyrum esculentum Moench: its antigenichomologywithseedproteinsofsomeothercrops.Biochem.Mol.Biol. Int 40 3 587–595. Schuppan D. Hahn E.G. 2002. Biomedicine. Gluten and the gut-lessons for immune regulation. Science 297 5590 2218–2220. Shan L. MolbergØ. ParrotI. Hausch F.Filiz F. Gray G.M. Sollid L.M. Khosla C. 2002.Structuralbasisforglutenintoleranceinceliacsprue.Science2975590 2275–2279. Shi L. Zhang J. Wu P. Feng K. Li J. Xie Z. Xue P. Cai T. Cui Z. Chen X. Hou J. Zhang J. Yang F. 2009. Discoveryand identification of potential biomarkers of pediatric acute lymphoblastic leukemia. Proteome Sci 7 7. Shibata T. Nagayasu H. Kitajo H. Arisue M. Yamashita T. Hatakeyama D. Iwasaki T. Kobayashi H. 2006. Inhibitory effects of fermented brown rice and rice bran on the development of acute hepatitis in Long-Evans Cinnamon rats. Oncol. Rep 15 4 869–874. Sollid L.M. 2002. Celiac disease: dissecting a complex inflammatory disorder. Nature Reviews. Immunology 2 9 647–655. Tomita H. Kuno T. Yamada Y. Oyama T. Asano N. Miyazaki Y. Baba S. Taguchi A. Hara A. Iwasaki T. Kobayashi H. Mori H. 2008. Preventive effect of fermented brown rice and rice bran on N-methyl-N’-nitro-N-nitro- soguanidine-induced gastric carcinogenesis in rats. Oncol. Rep 19 111–15. Villareal R.M. Juliano B.O. 1977. Some properties of 3-phosphoglycerate phos- phatase from developing rice grain. Plant Physiol 59 2134–138. Yamagata H. Nomura T. Arai S. Tanaka K. Iwasaki T.1992. Nucleotide sequence of a cDNAthat encodes a rice prolamin. Biosci. Biotechnol. Biochem 56 3 537. Yamazaki K. Murray J.A. Kita H. 2008. Innate immunomodulatory effects of cereal grains through induction of IL-10. J. Allergy Clin. Immunol 121 1 172–178. Yang L. Kumagai T. Kawamura H. Watanabe T. Kubota M. Fujimura S. Watanabe R. Kadowaki M. 2007. Effects of rice proteins from two cultivars KoshihikariandShunyoon cholesteroland triglyceride metabolism ingrowing and adult rats. Biosci. Biotechnol. Biochem 71 3 694–703. Y.-J. Chen et al. / Journal of Cereal Science 51 2010 189–197 197

slide 25:

Reactivity of gluten detecting monoclonal antibodies to a gliadin reference material R. van Eckert a J. Bond a P.Rawson a Ch.L. Klein b M. Stern c T.W. Jordan a a Centre for Biodiscovery and School of Biological Sciences Victoria University of Wellington Kelburn Parade Wellington New Zealand b European Commission Directorate-General Joint Research Centre JRC Institute for Health and Consumer Protection IHCP Via E. Fermi 21027 Ispra Italy c University Children’s Hospital Hoppe-Seyler-Str. 1 72076 Tu ¨bingen Germany article info Article history: Received 2 September 2009 Received in revised form 23 November 2009 Accepted 26 November 2009 Keywords: Gluten detection Antibody reaction Two-dimensional gel electrophoresis Coeliac Disease Fluorescent dyes Cy3 and Cy5 Coomassie Blue stain abstract People affected by coeliac disease need to adhere to a life-long gluten-free diet to avoid symptoms. ELISA-tests are seen as the mainstay for the detection of gluten in gluten-free food because of their sensitivity. They can however yield different gluten amounts depending on the antibody and reference material used. We compared the reactivity of three prominent mouse anti-gliadin-antibodies to a reference gliadin isolated from 28 common bred European wheat varieties. The reference material proteins were labelled with fluorescent dye Cy3. They were then separated by 2DE and transferred by Western blot onto low fluorescent PVDF-membranes followed by incubation with the three primary anti-gliadin antibodies one by one. Detection of the reacting proteins used anti-mouse antibody which was labelled with fluorescent dye Cy5. The use of this technique made it possible to co-detect the 2DE- image of the reference material proteins Cy3 and proteins reacting with the respective antibody Cy5. The three investigated antibodies had dissimilar reactivities with different proteins of the reference gliadin. Antibodies R5 and PN3 reacted mainly with gliadin fractions antibody 401.21 mainly with high molecular weight glutenins. The results confirm the individual specificity of these antibodies and demonstrate the importance of validating immunochemical methods for gluten detection. 2009 Elsevier Ltd. All rights reserved. 1. Introduction Coeliac disease is one of the most frequent food intolerances worldwide with a prevalence of 1 in 100–300 individuals Wieser and Koehler 2008. It is triggered by the ingestion of wheat rye barley and possibly oat proteins. The disease provoking proteins generally called ‘gluten’ are storage proteins of the named cereals and their crossbred varieties. Affected people can only avoid symp- toms by maintaining a strict gluten-free diet for their entire life. As gluten-free food can be accidentally contaminated with coeliac active cereals during harvesting transport storage or processing vanEckertetal.1992areliableandsensitivedetectionmethodfor gluten is required to make sure that coeliac patients have access to food which is guaranteed to be gluten-free. The gluten content of gluten-free food is being regulated by the worldwide Codex Stan- dard for Gluten-Free Foods Codex Stan 1181981 which has been under revision for many years. The latest Draft Revised Codex Standard of the FDA/WHO Codex Alimentarius Commission 2007 has now been adopted Codex Alimentarius Commission 2008. It allows a maximum gluten level of 20mg/kg in total for gluten-free food based on the food as sold or distributed. Traditionally gluten proteins have been divided into the alcohol soluble prolamins and the alcohol insoluble glutelins Osborne 1924. Historically only prolamins were seen as being coeliac active explaining why most gluten ELISAs determined the content of the prolamins only. The gluten content was then approximated by doubling the prolamin content based on the assumption that prolamins and glutelins were present in gluten in similar amounts. The term prolamin has also been used for both prolamins and glutelins after disulfide reduction by Shewry et al. 1984. We use the terms prolamin and glutelin in this publication for separate protein groups in accordance with the Osborne classification. Abbreviations: Cy3 fluorescent dye CyDye DIGE Fluor Cy 3 Cy5 fluorescent dye CyDye DIGE Fluor Cy 5 HMW high molecular weight IRMM Institute for Reference Materials and Measurements LMW low molecular weight mAb monoclonal antibody PWG-gliadin reference gliadin provided by WGPAT TBS Tris-buffered saline TTBS Tris-buffered saline containing Tween 20 2DE two- dimensional gelelectrophoresis WGPAT WorkingGroup on Prolamin Analysis and Toxicity. Corresponding author. Centre for Biodiscovery and School of Biological Sciences Victoria University of Wellington P.O. Box 600 Wellington New Zealand. Tel.:þ64 4 463 6258 fax:þ64 4 463 5331. E-mail address: renate.vaneckertvuw.ac.nz R. van Eckert. Contents lists available at ScienceDirect Journal of Cereal Science journal homepage: www.elsevier.com/locate/jcs 0733-5210/ – see front matter 2009 Elsevier Ltd. All rights reserved. doi:10.1016/j.jcs.2009.11.012 Journal of Cereal Science 51 2010 198–204

slide 26:

TodayELISA-methodsareseenasthestateoftheartanalysesfor the detection of gluten in food because of their sensitivity and specificity. Many gluten ELISAs have been developed. They are based on a variety of antibodies all detecting gluten with a high sensitivityseeoverviewofBermudoRedondoetal.2005Denery- Papini et al. 1999. The problem however is that the results between different assays can vary dramatically. van Eckert et al. 19931997 1998 2000 demonstrated that the amount of gluten detected with commercial gluten assays is strongly dependent on the antibody and reference material used. Patient groups and medicalprofessionalsrequestedalowdetectionlimitwhichcould not be guaranteed because of the high variations of the results. TheWorkingGrouponProlaminAnalysisandToxicityWGPAT made a step towards the standardisation of the test results by providing a reference gliadin called ‘PWG-gliadin’ representative for 28 most bred European wheat varieties. The isolation and characterisation of the material was described by van Eckert et al. 2006. Variation of the response of different gliadin preparations in different ELISAs was demonstrated again. Included in this study werethree monoclonalmouse antibodies mAbs ‘401.21’ ‘R5’ and ‘PN3’ which have beenwidely employed in various gluten detect- ingsystems:MAb401.21wasdevelopedbySkerrittandHill1990. It hasbeenused in anassay validated bythe Association of Official Analytical Chemists AOAC Skerritt and Hill 1991 ring tested successfullyandmarketedbyseveralcompanies.AntibodyPN3has been raised against a synthetic peptide of A-gliadin ‘Aggregable’ a-gliadin Ellis et al.1998 which had been demonstrated to cause mucosal damage of coeliac patients in vivo and in vitro Shidrawi et al. 1995 Sturgess et al. 1994. Antibody R5 was developed by Sorelletal.1988.Theassaybasedonthisantibodyhasbeentested byseverallaboratoriesMe ´ndezetal.2005andadoptedasaType 1 method in the Revised Codex Standard for Foods for Special Dietary Use for Persons Intolerant to Gluten Codex Alimentarius Commission 2008. It is being marketed by two companies and a collaborative study manuscript to become an Official Method status of AOAC has been submitted for review. The reactivities of these antibodies however differ substan- tially resulting in uncertainties in measurement of gluten content which could not be explained until now Seilmeier and Wieser 2003 van Eckert et al. 1997 1998 2000 Wieser 1997. We have thereforeinitiatedcomparisonofthereactivityoftheseanti-gluten antibodies to PWG-gliadin separated by two-dimensional elec- trophoresis2DEtomorecompletelycharacterisethereactivityof each antibody with individual gluten proteins. 2. Experimental The chemicals used were of analytical grade if not stated otherwise. 2.1. Materials PWG-gliadin was produced and characterised on behalf of the Working Group on Prolamin Analysis and Toxicity WGPAT www. wgpat.com.ar described by van Eckert et al. 2006. It was then further freeze-dried and aliquoted in 100mg amounts under an inert gas atmosphere using argon by the Institute for Reference Materials and Measurements IRMM Geel Belgium as described byKleinetal.2004.Afterthisadditionalfreeze-dryingprocessthe materialhadaproteincontentof96.9DumasN 5.7determined byH.WieserGermany.Thetotalgliadincontentamountedthento 93.6 consisting of 67.7 monomeric and 28.9 high molecular weight HMW-gliadins van Eckert et al. 2006. PWG-gliadin is available from Prof. Dr. Martin Stern Martin.Sternmed.uni- tuebingen.de. 25mg gliadin material was dissolved in 25mL 60 v/v ethanol. Aliquots of the solution were vacuum dried at room temperature in a Centrivap concentrator Labconco to provide exactamountsforfurtheranalyses.Thevacuumdriedportionswere keptat4–8 C until neededand re-suspended priortouse. FluorescentlabellingdyeusedforlabellingofPWG-gliadinwas CyDye DIGE Fluor Cy 3 Cy3 minimal dye GE-Healthcare 25- 8010-83. 2.1.1. Antibodies 2.1.1.1. Primary antibodies. 1. 401.21 mAb to gliadins Concentration: 2.03mg/mL batch 154-035. This IgG1 antibody was developed by Skerritt and Hill 1990 against a gliadin extract of the Australian bread wheat cultivar Timgalen Skerritt et al. 1984.ItwaskindlyprovidedbyVitalDiagnosticsPtyLtdAustralia. Company specification suggests that mAb 401.21 reacts mainly with u-gliadins. The antibody has been used for the detection of gluten in commercial assays such as the gluten assay test kit of CortecsnowBioKitsGlutenAssayKitTepnelBioSystemsLtd.UK RIDASCREEN Gluten Kit R6101 the former test system of R-Bio- pharmAGGermanyandTransiaPlateGlutenTransiaGmbHUK. 2. PN3 mAb to a synthetic peptide of A-gliadin Concentration:1.4mg/mL.ThisIgG1antibodywas produced by Julia Ellis Ellis et al. 1998 and kindly provided by the research group ofPaulCiclitiraSt.Thomas’sHospitalLondonUK.Theanti- bodywasraisedagainstasynthetic19-merpeptideequivalenttothe amino acids 31–49 of A-gliadin LGQQQPFPPQQPYPQPQPF which had been shown to cause mucosal damage to the small bowel of coeliac patients both in vivo and in vitro Shidrawi et al. 1995 Sturgessetal.1994.PN3-mAbreactstoasimilardegreewithcoeliac activeprolaminsofwheatgliadinsryesecalinsbarleyhordeins and oats avenins and also with low molecular weight LMW- glutenins. According to preliminary data this mAb does not react withHMW-gluteninsBermudoRedondoetal.2005. 3. R5 mAb to secalins Concentration:15.2mg/mL lot/Cad: 01.01/09.14. ThisIgG2banti- body has been developed by the research group of Enrique Me ´ndez andwaspurchasedfromthecompanyOperonS.A.CuartedeHuerva Spain.Theantibodywasraised againstasecalinextractSorell et al. 1988 and recognises gliadins hordeins and secalins to a similar degree. It does not recognise avenins. It is being used in commercial assays such as RIDASCREEN Gliadin which is the recent gluten detectingkitofR-BiopharmAGGermanyandintheassayINGEZIM GLUTEN from Ingenasa Spain. ELISA based on the R5-antibody has beenendorsedasaType1methodintheRevisedCodexStandardfor FoodsforSpecialDietaryUseforPersonsIntoleranttoGlutenCodex AlimentariusCommission2008.TheR-Biopharmglutentestkithas beencertifiedbyAOACtoperformasstatedbythemanufacturer. 2.1.1.2. Secondary antibody. ECL Plex goat anti mouse IgG labelled with fluorescent dye CyDye DIGE Fluor Cy 5 Cy5 GE-Healthcare PA 45009 reconstituted 1mg/mL inwater before use. 2.2. Electrophoresis and Western blot Dot blot experiments on Immobilon-FL membranes Millipore S1EJ084E03 and one-dimensional electrophoresis on NuPAGE R. van Eckert et al. / Journal of Cereal Science 51 2010 198–204 199

slide 27:

4–12 Bis Tris Gels Invitrogen NP0322BOX were used to deter- mine the optimal working dilution of the antibodies and to opti- miseblotandwashingconditions. 2DEWesternblotandantibody reaction were then performed for each primary antibody and the washing conditions were further optimised. Then four replicates were produced according to the procedure described below. 2.2.1. Labelling of gliadin with Cy3 according toTonge et al. 2001 Lysis buffer: 30mmol/L Tris buffer containing 7mol/L urea 2mol/Lthioureaand4w/vCHAPSpH8.5adjustedwithdiluted HCl. Cy3 working solution: Solid Cy3 was dissolved in 5mL dime- thylformamide and then diluted 1:5 with dimethylformamide to a concentration of 200pmol Cy3/mL. Cy3 labelled gliadin solution: An aliquot of 40mg vacuum dried PWG-gliadin was dissolved in 4mLlysis-buffer.ThepHwasadjustedabove8.5with2mL1.5mol/L Tris buffer of pH 8.8. Then 1.4mL Cy3 working solutionwas added. The solution was mixed centrifuged and left on ice in the dark. After 30min the reactionwas stopped with 1mL 10mmol/L lysine. The Cy3 labelled PWG-gliadin solution was then mixed centri- fuged maintained on ice for 10min and either stored at 80 Cor used immediately. 2.2.2. Two-dimensional electrophoresis Samplesolution:8mol/Lurea3mol/Lthiourea4CHAPSsome crystals of bromophenol blue. Marker: Precision Plus Protein Stan- dardsDualColourBio-Rad161-0374diluted1:100withNuPAGE LDS Sample Buffer Invitrogen NP0007 and Sample Reducing Agent Invitrogen NP0004. Sample rehydration solution: 1.5mLof Cy3 labelled PWG-gliadin solution containing approximately 7mg gliadin protein was diluted with 55mL sample solution. Then 65mmol/Ldithiothreitol10v/visopropanol2v/vIPG-buffer pH 3–10 GE-Healthcare 17-6000-87 and 50 v/v DeStreak RehydrationSolutionGE-Healthcare17-6003-19wereadded.The solution was vortexed allowed to stand for 0.5h and centrifuged 13000rpm Biofuge A Heraeus Sepatech. Procedure: 125mLof samplerehydrationsolutionwereusedforovernightrehydrationof 7cmImmobiline DryStripspH3–10GE-Healthcare17-6003-11 in the dark. Isoelectric focusing was performed on a Multiphor II GE-Healthcare. The cathodic electrode wicks were wetted with sample rehydration solution but without sample as described by Hoving et al. 2002. SDS gel electrophoresis was carried out on NuPAGE4–12BisTrisGelsInvitrogenNP0330BOXwithNuPAGE MOPSSDSrunningbufferInvitrogenNP0001.Gelswerescanned on a Fujifilm FLA-5100 fluorescent scanner Fuji Photo Film Co. Ltd. with a 532nm laser and a PBG/570DF20 emission filter. Coomassie Blue stained gels were prepared by loading 7cm Immobiline Dry Strips pH 3–10 with 25mg PWG-gliadin approximately23mggliadinproteinwhichwasdissolveddirectly in sample buffer. Isoelectric focusing and SDS gel electrophoresis wereperformed as described above. Afterelectrophoresis the gels were stained with colloidal Coomassie Brilliant Blue G-250 Bio- Rad161-0406 according to Anderson et al. 1996 kept in water for 0.5h and scanned on a Personal Densitometer SI Molecular Dynamics. 2.2.3. Western blot Transfer buffer: 25mmol/L Tris pH 8.3192mmol/L glycine15 methanol.Procedure:After2DEthegelswerescannedinwaterwith the fluorescent scanner and then equilibrated in transfer buffer. Low-fluorescent PVDF-membranes Millipore S1EJ084E03 were activated with methanol for 30s and then equilibrated with transferbufferfor5min.Each2DE-gelwasassembledwithaPVDF- membrane and two pieces of filterpaperon each side of the stack. The transfer was performed in a Bio-Rad Trans-blot R -Cell at 300V 400mA for 3h at 4 C in the dark. 2.2.4. Antibody reaction TBS Tris-buffered saline-buffer: 50mmol/L Tris pH 7.5 150mmol/L NaCl. TTBS-buffer: 0.1 v/v Tween 20 in TBS-buffer. Blocking buffer: 10 w/v skim milk powder Basics Instant Skim Milk Powder in TBS-buffer. Procedure: After each electrophoresis and blot experiment the gels and membranes were scanned to ensureoptimalseparationandtransferconditions.Themembranes werethenincubated with blocking bufferatroomtemperaturefor 3h.Thentheprimaryantibodieswereaddedindilutionsof1:4000 for mAb 401.21 1:500 for mAb PN3 and 1:2500 for mAb R5 in blockingbuffer.TheincubationtimeformAb401.21was1handfor mAbsPN3andR51.5h.Themembraneswerethenwashedseveral times with TTBS and subsequently with TBS. Finally they were incubatedwithCy5labelledanti-mouseIgGdiluted1:2500inTBS- buffer for 1h at room temperature. Another intense washing programwith TTBS and TBS was followed. 2.2.5. Evaluation of results Cy3 and Cy5 2DE-images were scanned simultaneously at two different wavelengths using the Fujifilm FLA-5100 fluorescent scanner: Cy3 images labelled PWG-proteins were scanned using a 532nm laser and a PBG/570DF20 emission filterand Cy5 images proteins reacting with the respective antibody using a 635nm laser and a DBR1/R665 emission filter. The gel analysis was per- formed with ImageMaster 2D Platinum 6.0 and ImageQuant TL v2003.02 both GE-Healthcare. 3. Results The comparison of Coomassie Blue stained Fig. 1a and Cy3 labelled Fig. 1b 2DE-images showed that both techniques gave asimilarproteinpattern.Resolutionandsensitivitywerehowever remarkably better in the fluorescent labelling approach. Low- abundant proteins which could not be detected with Coomassie Bluewerevisiblewhenfluorescentlabelledeventhoughlessthan one-third of the amount of gliadin was applied. The fluorescence method allowed us to monitor gels and membranes at any stage withouttheneedforanyadditionalchemicalreactionorstain.Thus we optimised Western blot conditions making sure that the protein transferwas completeand that the proteinpattern did not change during the transfer and antibody reactions Figs. 1b and c and 2a. The similarity of the protein patterns of the 2DE-gel and 2DE-image of the transferred proteins is obvious Fig. 1b and c. Blotted protein spots were slightly enlarged in comparison to the original spots probably due to diffusion. The protein pattern remained the same during each antibody reaction with all incu- bation and washing steps compare Fig.1c and 2a. Some proteins located in the migration area of u-gliadins and LMW-glutenins were less intense after the completed antibody reaction though see spots within the rectangle in Figs.1c and 2a. We assume that theydiffusedoutofthemembraneduringthestringentincubation andwashingregimewhichwasintroducedafterfirstresultsofthe mAb 401.21 reaction had shown a smear like formation in the HMW-area. The allocation of the reacting proteins to gliadin sub-types was madeonthebasisof theirapparentmolecularweightknownfrom our results and published data. Sizes determined by SDS-PAGE are reported by Wieser 1995 as 32000 for a- 38000–42000 for g- 55000–65000 for u 1/2 - and 66000–79000 for u 5 -gliadins and 36000–44000 for LMW- 90000–102000 for y-HMW- and 104000–124000 for x-HMW-glutenin subunits. Our results of SDS-PAGE and 2DE of gliadin sub-fractions which had been iso- lated by acidic polyacrylamide gel electrophoresis were in agree- ment with those published data results not shown. Additionally R. van Eckert et al. / Journal of Cereal Science 51 2010 198–204 200

slide 28:

Thompson et al. 1994 divided LMW-glutenins into group B 42000–51000 and group C LMW-glutenins 30000–40000. Each of the three antibodies reacted with different proteins on the 2DE-map of the PWG-gliadin. Fig. 2a shows the 2DE-image of the blotted Cy3 labelled proteins detected after the completed antibody-reaction.Fig.2b–ddisplaythe2DE-mapofthoseproteins reactingwiththerespectiveantibodydetectedatthesametimeas the Cy3 labelled gliadin. Overlays of the Cy3 labelled proteins and the Cy5 labelled antibody reacting proteins for each antibody are shown in the supplementary data. Monoclonal antibody 401.21 reacted primarily with proteins of an approximate molecular weight of 60000 and above. It showed reaction with HMW-glutenin subunits presumably LMW-glu- tenins u-gliadins and to a small degree with a- and g-gliadins Fig. 2b and Fig. S1a. This antibody reacted not only with defined protein spots but also with a number of not well resolved proteins in the HMW-area above a relative molecular weight of about 100000. The reaction in the HMW-area made up most of the entire antibody-reaction. We used high percentages of up to 10 skim milk powder both in the blocking and incubation buffer and also an extensive and stringent washing regime to exclude that the smear in this area was due to unspecific reactions. The same procedure was then applied to the PN3- and R5-antibody reaction. Monoclonal antibody PN3 reacted very selectively with gliadins of an apparent mass of about 30000 and higher Fig. 2c and Fig.S1bwhichcorrespondstothesizeofa-gliadins.PN3-antibody had been raised against a peptide from A-gliadin an a-gliadin fraction Kasarda et al.1984. The position of the reacting protein spotsinFig.2candtheoverlayFig.S1bsuggestthatthisantibody reactsspecificallywitha-gliadins.Eventhoughmostofthereacting proteins were smaller sized gliadins the antibody also reacted slightly with proteins of an apparent mass smaller than 75000. Monoclonal antibody R5 reacted strongly with gliadin proteins overthewholerangeofa-andg-gliadinsFig.2dandFig.S1c.The reaction was especially strong with proteins of a lower pI of both a- andg-gliadins the reactionwithg-gliadins being the strongest. The R5-antibody also showed minimal reaction with proteins of asizeofapproximately50000orhigherandaremarkablereaction withabulkoflowabundantproteinsofasizeof75000andhigher presumably u-gliadins. In summary each antibody detects different sets of proteins. PN3-mAb shows reaction mainly with a-gliadins and R5-mAb mainly with a- g- and presumably also u-gliadins. 401.21-mAb reacts with u-gliadins presumably LMW-glutenins to a high extent with HMW-glutenin subunits and to a low degree with a- and g-gliadins. 4. Discussion Thefluorescenttechniquewasanefficientapproachtocompare the reaction of the three antibodies. In combination with 2DE it Fig.1. Two-dimensional electrophoresis of PWG-gliadin on 7cm NuPAGE 4–12 Bis Tris Gels. a 2DE of 25mg gliadin proteins stained with Coomassie Blue G-250. b 2DE of 7mg gliadin proteins fluorescent labelled with Cy3 532nm. c 2DE-image of 7mg fluorescent labelled gliadin proteins Cy3 after Western blot the box region indicates differences in protein intensity before and after mAb reaction compare Fig. 2a. R. van Eckert et al. / Journal of Cereal Science 51 2010 198–204 201

slide 29:

allowed detection of the reacting protein sets. Highsensitivitywas achieved in spite of the fact that CyDye DIGE Fluor minimal dyes GE Healthcare are binding to the epsilon amino group of lysine and gluten proteins are known to contain relatively few lysine residues Gianibelli et al. 2001. These dyes contain N-hydroxy succinimidyl esters that react to form amides with lysine 3-amino groupsonproteins.ThevariousCyDyereagentsaresizeandcharge matched and the dye-protein stoichiometry during reaction is expectedtoaddasingledyemoleculetoeachproteinwithminimal effects on the charge and pI of the labelled protein Tonge et al. 2001. Some proteins which migrated in the area ofu-gliadins and/or LMW-gluteninsdiffusedoutofthemembraneduringtheantibody incubation and washing regime. This observation is in agreement with findings of Hurkman and Tanaka 2004 who noticed a reduction in colloidal Coomassie Blue G-250 staining of u-glia- dins when the stained gels were left in water for 3–24h. van den Broeck et al. 2008 also observed the disappearance of u-gliadins as well as LMW-glutenins and some a-gliadins after destaining Coomassiestainedgelswith10ethanol/7.5aceticacid.Diffusion might therefore have diminished the reaction especially of u-gliadins and LMW-glutenins and might have led to an under- estimation of the reaction of those proteins. The results show clearly that each antibody investigated detects different sets of different sub-types of gluten proteins to a different degree. This means that the gluten amounts detected with those antibodies are dependenton the gluten composition of the sample analysed and of the reference material used. This hypothesis was proposed previously but could not be illustrated. The results presented here demonstrate that this assumption was correct. As 401.21mAb is one of the longest commercially avail- able antibodies most data have been accrued for this antibody: Using the gluten assay test kit of Cortecs now Tepnel Bio- Systems which is based on the 401.21mAb and promoted as detecting mainly u-gliadins van Eckert 1993 noted variable reactivity of the antibody between commercially and laboratory produced gliadin preparations. Furthermore gliadin extracted by H. Wieser Wieser et al.1998 in the laboratory with 40 ethanol v/v reacted stronger than gliadin extracted with 70 ethanol v/ v. It was assumed that 40 ethanol extracted more u-gliadins than 70 ethanol Wieser and Belitz 1992 and thus delivered a higher assay response. The low reaction of the laboratory prepared gliadinscomparedtothose prepared commerciallycould not be explained just by the difference in their u-gliadin-content van Eckert et al. 1997 Wieser 1997. van Eckert et al. 1998 found that the u-gliadins of the wheat variety ‘Timgalen’ the basis for the reference material in the Cortecs kit reacted to a higher extent with the mAb than those of the variety ‘Rektor’ the basis for the laboratory prepared gliadin. Again this difference in reactivity was not as high as the variation of the results. Other gliadin fractions were investigated and cross-reaction with a- gliadins Seilmeier and Wieser 2003 and with a- and g-gliadins van Eckert et al. 1997 1998 2000 was found. In fact Hill and Skerritt 1989 had described mAb 401.21 as binding to certain u- gliadins and to HMW- and LMW-glutenins and Skerritt et al. 1989 detected appreciable binding to a-gliadins. The findings of Fig. 2. Reaction of 7 mg PWG-gliadin proteins with mAbs Cy5 635nm after 2DE and Western blot. a Control: Fluorescent labelled PWG-gliadin Cy3 scanned at 532nm after completedPN3-antibody-reactionrepresentativeforthereactionofallthreemAbs.bReactionofgliadinproteinswithmAb401.21.cReactionofgliadinproteinswith mAbPN3. d Reaction of gliadin proteins with mAb R5. R. van Eckert et al. / Journal of Cereal Science 51 2010 198–204 202

slide 30:

the present study bring the reactivity of the various gluten frac- tions into relation to each other. MAb 401.21 reacts primarily with HMW-glutenin subunits which explains why the laboratory produced preparations reacted to a lower extent: They contained mainly gliadins and not many HMW-glutenin subunits. The present results also explain why Gluten RM 8418 exhibited a stronger response than PWG-gliadin with this antibody van Eckert et al. 2006. Gluten RM 8418 is a sample composed of gliadins plus glutenins ¼gluten whereas PWG-gliadin is a 60- ethanol soluble extract from flour in which gliadins are strongly enriched. PN3-antibody recognises very distinctively mainly a-gliadins. These findings fit very well to the fact that it was raised against a peptide from A-gliadin LGQQQPFPPQQPYPQPQPF an a-gliadin fraction. Ellis et al. 1998 suggested that this antibody mainly reactedwiththeepitopeQQQPFPwhichisfoundina-gliadinsbut not in g-gliadins. Our findings confirm that this antibody detects relatively specifically a-gliadins. The results are also in agreement with findings of Bermudo Redondo et al. 2005 who did not observe reactions with HMW-glutenins. R5-antibody recognises the epitope with the amino acid sequence QQPFP the greatest Valde ´s et al. 2003 and also reacts with homologous repeats such as QQQFP LQPFP and QLPFP Kahlenberg et al. 2006. The QQPFP-epitope occurs repeatedly in a- g- and u-gliadins. It is part of the coeliac active peptide of the A-gliadin to which the PN3-antibody was raised and contains only oneQlessthantheepitopeQQQPFPthemainreactantepitopewith thePN3-antibody.Ithoweveroccursmoreoftening-andu-than in a-gliadins Osman et al. 2001. This is in agreement with our observation that g-gliadins show a high response with the R5-antibody. R5 mAb also showed a remarkable response with u-gliadins which contain the repetitive sequence of PQQPFPQQ frequently Wieser 2007. The diffusion of u-gliadins during the incubation and washing regime of the antibody reactions might have diminished their response. We did not observe high reaction with glutenins which again is in agreement with assumptions of Kahlenberg et al. 2006 who suggested that glutenins did not contain many QQPFP- and QQQFP-epitopes. 5. Summary and conclusions Inthepresentstudythereactivityoftwocommerciallyandone scientificallypreparedantibodywascompared.Eventhoughtwoof the antibodies are known to react with a similar amino acid sequence they detected different individual proteins. It was possible to assess the relative reactivity of protein sets with each antibody and thus to explain why gluten analysis with different antibodies can result in different gluten amounts as was observed in the past. As gluten is a heterogeneous mixture of many indi- vidual proteins the gluten amount detected depends strongly on theantibody’specificity.Thedetectedglutenamountalsodepends on the reference material used which needs to be representative and well characterised. PWG-gliadin which was used in this study fulfils those requirements. It was produced from 28 of the most common European wheat varieties and contains a representative mixture of gliadin components van Eckert et al. 2006. The material shows good solubility and as gliadins and glutenins cannotbeseparatedcompletelyfromeachotherbyextractionwith aqueous alcohol Wieser 1995 contains also LMW- and HMW- glutenins Denery-Papini et al. 2001 HMW-glutenins can also be seen in Fig 1. Recent studies have shown that glutenins carry coeliac activity as well Dewar et al. 2006. As the gliadin and glutenin amounts vary between wheat samples new efforts are being made to detect both gliadin and glutenin proteins individu- ally. Thegliadin and glutenin contentof the PWG-gliadin might be used for gluten determination but a reliable determination of the glutenin content is required to make PWG-gliadin suited for both prolaminandglutelindetection.Alternativelyagluteninreference material could be used which would however be difficult to standardise because of solubility and reoxidation problems. MAb 401.21 seems to recognise HMW-glutenin subunits strongly and might therefore be a candidate for glutenin detecting antibodies whilemAbsPN3andR5detectmainlygliadinsandwouldbesuited for gliadin detection. A mixture of antibodies which recognise gliadins and glutenins to similar degrees in combination with a well characterised reference material might be the basis for a reliable determination of the content of gluten in gluten-free foods. Acknowledgements We thank Dr. Herbert Wieser for kindly providing gliadin preparationsdeterminationoftheproteincontentofPWG-gliadin andforusefuldiscussions.WefurtherthankProf.PaulCiclitiraand Dr. Julia Ellis for providing antibody PN3 the late Dr. Enrique Me ´ndez and the company Operon S.A. Spain for providing anti- body R5 and Vital Diagnostics Pty Ltd Australia for providing antibody 401.21. We thank Dr. Heinz Schimmel Institute for Reference Materials and Measurements IRMM of the European Commission Joint Research Centre Geel Belgium for funding Extended characterisation study of Gliadin from Europeanwheat B030333. Appendix. Supplementary data Supplementarydataassociatedwiththisarticlecanbefoundin the online version at doi:10.1016/j.jcs.2009.11.012. References Anderson N.L. Esquer-Blasco R. Richardson F. Foxworthy P. Eacho P.1996. The effects of peroxisome proliferators on protein abundances in mouse liver. Toxicology and Applied Pharmacology 137 75–89. Bermudo Redondo M.C. Griffin P.B. Garzon Rasanz M. Ellis H.J. Ciciltira P.J. O’Sullivan C.K. 2005. Monoclonal antibody-based competitive assay for the sensitive detection of coeliac disease toxic prolamins. Analytica Chimica Acta 551105–114. Codex Alimentarius Commission 2007. Report of the 29th session of the Codex CommitteeonNutritionandFoodsforSpecialDietary uses.DraftrevisedCodex Standard for Foods for Special Dietary Use for Persons Intolerant to Gluten. Codex Alimentarius Alinorm 08/31/26 para. 64 and Appendix III Rome Italy pp. 50–51. Codex Alimentarius Commission 2008. Report of the 31st session of the CodexCommitteeonNutritionandFoodsforSpecialDietaryuses.RevisedCodex StandardforFoodsforSpecialDietaryUseforPersonsIntoleranttoGluten.Codex AlimentariusAlinorm08/31/REPAppendixVIIGenevaSwitzerlandp.107. Denery-Papini S. Nicolas Y. Popineau Y. 1999. Efficiency and limitations of immunochemical assays for the testing of gluten-free foods. Journal of Cereal Science 30121–131. Denery-Papini S. Pineau F. Deshayes G. 2001. Characterisation of the European gliadin standard. In: Stern M. Ed. Proceedings of the 15th Meeting Working Group on Prolamin Analysis and Toxicity. Tu ¨bingen pp. 83–85. Dewar D.H. Amato M. Ellis J. Pollock E.L. Gonzalez-Cinca N. Wieser H. Ciclitira P.J. 2006. The toxicity of high molecular weight glutenin subunits of wheat to patients with coeliac disease. EuropeanJournal of Gastroenterology Hepatology 18 483–491. Ellis H.J. Rosen-Bronson S. O’Reilly N. Ciclitira P.J.1998. Measurement of gluten usingamonoclonalantibodyagainstaCoeliactoxicpeptideofAgliadin.Gut43 190–195. Gianibelli M.C. Larroque O.R. MacRitchie F. Wrigley C.W. 2001. Biochemical genetic and molecular characterization of wheat glutenin and its component subunits. Cereal Chemistry 78 635–646. Hill A. Skerritt J.H.1989. Monoclonal antibody based two-site enzyme immuno- assays forwheat glutenproteins.1.Kinetic characteristics and comparisonwith other ELISA formats. Food and Agricultural Immunology 1147–160. Hoving S. Gerrits B. Voshol H. Mu ¨ller D. Roberts R.C. van Oostrum J. 2002. Preparative two-dimensional gel electrophoresis at alkaline pH using narrow range immobilized pH gradients. Proteomics 2 127–134. R. van Eckert et al. / Journal of Cereal Science 51 2010 198–204 203

slide 31:

Hurkman W.J. Tanaka C.K. 2004. Improved methods for separation of wheat endosperm proteins and analysis by two-dimensional gel electrophoresis. Journal of Cereal Science 40 295–299. Kahlenberg F. Sanchez D. Lachmann I. Tuckova L. Tlaskalova H. Me ´ndez E. Mothes T. 2006. Monoclonal antibody R5 for detection of putatively coeliac- toxic gliadin peptides. Eur Food Res Technol 222 78–82. Kasarda D.D. Okita T.W. Bernardin J.E. Baecker P.A. Nimmo C.C. Lew E.J.L. Dietler M.D. Greene F.C.1984. Nucleic acid cDNA and amino acid sequences ofa-type gliadins fromwheat Tricitcum aestivum. Proceedings of the National Academy of Sciences of the United States of America 81 4712–4716. Klein C. Yazgan S. Franchini F. 2004. The certified reference material for gliadin from European wheat: status quo. In: Stern M. Ed. Proceedings of the 18th Meeting Working Group on Prolamin Analysis and Toxicity. Verlag Wissen- schaftliche Scripten Zwickau pp.125–127. Me ´ndez E. Vela C. Immer U. Janssen F.W. 2005. Report of a collaborative trial to investigate the performance of the R5 enzyme linked immunoassay to deter- mine gliadin in gluten-free food. European Journal of Gastroenterology Hepatology 171053–1063. OsborneT.B.1924.Thevegetableproteinsseconded.LongmansGreenCoLondon. Osman A.A. Uhlig H.H. Valde ´s I. Amin M. Me `ndez E. Mothes T. 2001. A monoclonal antibody that recognizes a potential coeliac-toxic repetitive pentapeptide epitope in gliadins. European Journal of Gastroenterology Hepatology 131189–1193. Seilmeier W. Wieser H. 2003. Comparative investigations of glutenproteins from different wheatspecies.IV.Reactivityofgliadinfractionsandcomponentsfrom differentwheatspeciesinacommercialimmunoassay.EuropeanFoodResearch and Technology 217 360–364. Shewry P.R. Miflin B.J. Kassarda D.D. 1984. The structural and evolutionary relationships of the prolamin storage proteins of barley rye and wheat. Philo- sophical Transactions of the Royal Society of London. Series B: Biological Sciences 304 297–308. Shidrawi R.G. Day P. Przemioslo R.T. Ellis H.J. Nelufer J.M. Ciclitira P.J.1995. In vitrotoxicityofglutenpeptidesassessedbyorganculture.ScandinavianJournal of Gastroenterology 30 758–763. Skerritt J.H. Smith R.A. Wrigley C.W. Underwood P.A. 1984. Monoclonal anti- bodies to gliadin proteins used to examine cereal grain protein homologies. Journal of Cereal Science 2 215–224. Skerritt J.H. Jenkins K.L. Hill A. 1989. Monoclonal antibody based two-site enzyme immunoassays for wheat gluten proteins. 2. Specificity analysis. Food and Agricultural Immunology 1161–171. SkerrittJ.H.HillA.S.1990.Monoclonalantibodysandwichenzymeimmunoassays fordeterminationofgluteninfoods.JournalofAgriculturalandFoodChemistry 381771–1778. Skerritt J.H. Hill A.S. 1991. Enzyme immunoassay for determination of gluten in foods: collaborative study. Journal of AOAC International 74 257–264. Sorell L. Lo ´pez J.A. Valde ´s I. Alfonso P. Camafeita E. Acevedo B. Chirdo F.G. Gavilondo J. Me ´ndez E.1988. An innovative sandwich ELISA system based on an antibody cocktail for gluten analysis. FEBS Letters 439 46–50. SturgessR.P.DayP.EllisH.J.LundinK.E.A.GjertsenH.A.KontakouM.CiclitiraP.J. 1994.WheatpeptidechallengeinCoeliacdisease.Lancet343758–761. Thompson S. Bishop D.H.L. Tatham A.S. Shewry P.R. 1994. Exploring disulfide bond formation in a low molecular weight subunit of wheat glutenin using a baculovious expression system. Gluten proteins 1993. Association of Cereal Research Detmold Germany. 345–355. Tonge R. Shaw J. Middleton B. Rowlinson R. Rayner S. Young J. Pognan F. Hawkins E. Currie I. Davison M. 2001. Validation and development of fluo- rescence two-dimensional differential gel electrophoresis proteomics tech- nology. Proteomics 1 377–396. Valde ´s I. Garcia E. Llorente M. Me ´ndez E. 2003. Innovative approach to low- level gluten determination in foods using a novel sandwich enzyme-linked immunosorbent assay protocol. European Journal of Gastroenterology Hep- atology 15 465–474. van den Broeck H.C. America A.H.P. Smulders M.J.M. Gilissen L.J.W.J. van der MeerI.M.2008.Stainingefficiencyofspecificproteinsdependsonthestaining method: Wheat gluten proteins. Proteomics 8 1880–1884. van Eckert R. Pfannhauser W. Riedl O. 1992. Beitrag zur Qualita ¨tssicherung bei der Herstellung von glutenfreien Lebensmitteln. Erna ¨hrung/Nutrition 16 511–512. van Eckert R.1993. Methodological and practical experience in gluten analysis. In: Stern M. Ed. Proceedings of the 7th Meeting Working Group on Prolamin Analysis and Toxicity. Tu ¨bingen pp. 83–86. van EckertR. ScharfM.WaldT.PfannhauserW.1997.Determinationof proteins with ELISA-Methods: Doubtful quantitative results In: Amado R. Battaglia R. Eds.ProceedingsofEUROFOODCHEMIXInterlakenSwitzerlandFECSEvent No. 220 vol.1 pp. 263–268. van Eckert R. Scharf M. Wald T. Repnegg F. Sima A. Pfannhauser W. 1998. Determinationofglutenin gluten-freefoods. In: Ortolani C.Czedic-Eysenberg P. Eds. Proceedings of the 7th International Symposium on Immunological Chemical and Clinical Problems in Food Allergy Giardini Naxos Taormina Italy p. 87. vanEckertR.WaldT.RepneggF.PfannhauserW.2000.Onthedeterminationof gluten using commercially available ELISA kits. In: Stern M. Ed. Proceedings of the 14th Meeting Working Group on Prolamin Analysis and Toxicity. Tu ¨bingen pp. 71–72. van Eckert R. Berghofer E. Ciclitira P.J. Chirdo F. Denery-Papini S. Ellis H.J. Ferranti P. Goodwin P. Immer U. Mamone G. Me ´ndez E. Mothes T. Novalin S. Osman A. Rumbo M. Stern M. Thorell L. Whim A. Wieser H. 2006. Towards a New Gliadin Reference Material - Isolation and Character- isation. Journal of Cereal Science 43 331–341. Wieser H. 1995. The precipitating factor in Coeliac disease. In: Baillie ´re’s Clinical Gastroenterology 9. Ballie `re Tindall London pp.191–207. Wieser H. 1997. Collaborative studies on the quantitative determination of gliadin in wheat starch. In: Stern M. Ed. Proceedings of the 11th Meeting Working Group on Prolamin Analysis and Toxicity. Tu ¨bingen pp. 43–60. Wieser H. Belitz H.D. 1992. Quantitative Bestimmung der Gliadin-Untergruppen verschiedener Weizensorten. Jahresbericht der Deutschen Forschungsanstalt fu ¨r Lebensmittelchemie Garching pp.152–167. Wieser H. Antes S. Seilmeier W. 1998. Quantitative determination of gluten protein types in wheat flour by reversed-phase high-performance liquid chromatography. Cereal Chemistry 75 644–650. Wieser H. 2007. Chemistry of gluten proteins. Food Microbiology 24115–119. Wieser H. Koehler P. 2008. The biochemical basis of coeliac disease. Cereal Chemistry 851–13. R. van Eckert et al. / Journal of Cereal Science 51 2010 198–204 204

slide 32:

Storage-induced changes in einkorn Triticum monococcum L. and breadwheat Triticum aestivum L. ssp. aestivum flours Andrea Brandolini a Alyssa Hidalgo b Luca Plizzari a a CRA-Unita ` di Ricerca per la Selezione dei Cereali e la Valorizzazione delle varieta ` vegetali SCV Via Forlani 3 26866 S. Angelo Lodigiano LO Italy b Dipartimento di Scienze e Tecnologie Alimentari e Microbiologiche DISTAM Universita ` degli Studi di Milano via Celoria 2 20133 Milano Italy article info Article history: Received 18 March 2009 Received in revised form 21 November 2009 Accepted 30 November 2009 Keywords: Alpha-amylase kinetics Falling number RVA SDS sedimentation abstract To assess the effect of ageing on alpha-amylase activity falling number pasting properties and SDS sedimentation volume whole meal and white flours of einkorn cv Monlis and bread wheat cv Serio were stored in darkness at different temperatures and analysed several times up to 374 days. Pregerminated bread wheat flours cv Blasco were also evaluated. Flour ageing deeply modified all the parameters examined. In general alpha-amylase activity decreased while falling number and viscosity increased. SDS sedimentation values showed an increase which in bread wheat flours was followed by a steep decline at high temperatures and a moderate decrease at low temperatures. Einkorn flours showed analogous trends for all the traits studied however SDS sedimentation had similar or higher values than the initial stand even after 374 days of storage at 38 C thus suggesting a more stable breadmaking performance during ageing. In general the changes were drastic at high temperatures 38 and 30 C but reduced or negligible at mediumandlowtemperatures205and 20 C.Storageimprovedthequalityofpregerminatedflours. 2009 Elsevier Ltd. All rights reserved. 1. Introduction With 217.4 million hectares wheat is the most widespread cereal in the world FAO 2007 and along with rice contributes most of the carbohydrates for human consumption. Wheat is har- vested during limited time periods but consumed all around the year. After harvesting the kernels are stored in bins or elevators where they are dried fumigated to control pests and possibly cooledwithaerationBailey1992. Mostof thewheatproduced in the world is then processed into white flour or semolina for the preparationofbreadbiscuitsorpasta.Theflourisstoredinsacksof differentmaterialandpreferablystockpiledincooldarkroomsfor varying periods of time: white flour has a shelf life of 12 months Catterall1998Edwards2007whilewholemealflourhasashelf life of three months Edwards 2007. Duringstorageseedsandflourundergodeepphysicalchemical and physiological modifications Pomeranz 1992 fostered by storage temperature moisture content atmospheric oxygen content light and microbial activity Tipples 1995 Wang and Flores 1999. Postmilling maturation influences colour composi- tion Hidalgo and Brandolini 2008a Hidalgo et al. 2009 and technological and pasting properties Salman and Copeland 2007 Wang and Flores 1999 of the flours. Among the technological changesobservedare:increaseinwaterbindingcapacityandbatter viscosity Shelke et al. 1992 falling number Hruskova and Machova 2002 starch gelatinisation temperature Shelke et al. 1992 and viscosity Salman and Copeland 2007 gluten elasticity Cenkowskietal.2000andbreadloafvolumeChenandShofield 1996. Interestingly improvement of some technological parame- tersinflourfrompresproutedwheatkernelshasalsobeenreported Ariyama and Khan1990. EinkornTriticum monococcumL.subsp.monococcumadiploid hulledwheatcloselyalliedtodurumandbreadwheatisapotential food source with high nutritional properties because of its higher protein Borghi et al. 1996 carotenoid Abdel Aal et al. 2002 Hidalgo et al. 2006 and tocol Hidalgo et al. 2006 contents coupled with some interesting technological properties Borghi et al.1996 Brandolini et al. 2008 Corbellini et al.1999. The objective of this research was therefore to assess the influence of flour ageing on several technological parameters of einkorn and bread wheat additionally it was of interest to understand if the quality of pregerminated wheat would improve during storage. To reach this goal alpha-amylase activity falling number pasting properties and SDS sedimentation volume of wholemealandwhiteflourfromoneeinkorncultivarMonlisnon pregerminated and two bread wheat cultivars Serio non pre- germinated and Blasco lightly pregerminated were repeatedly Corresponding author. Tel.:þ39 0250319189 fax:þ39 0250319199. E-mail address: alyssa.hidalgovidalunimi.it A. Hidalgo. Contents lists available at ScienceDirect Journal of Cereal Science journal homepage: www.elsevier.com/locate/jcs 0733-5210/ – see front matter 2009 Elsevier Ltd. All rights reserved. doi:10.1016/j.jcs.2009.11.013 Journal of Cereal Science 51 2010 205–212

slide 33:

measured up to 374 days during their storage at five different temperatures 20 5 20 30 and 38 C. 2. Experimental 2.1. Samples Kernels of einkorn cv Monlis recently released in Italy and particularlysuitedfor breadmaking and breadwheat cv Serio and Blasco were harvested with a plot combine in 2007 at S. Angelo L. Po plain Italy from 10m 2 plots with three replications cropped following standard cultural practices Castagna et al.1995. 2.2. Sample preparation Approximately 3kg of recently harvested seeds of the einkorn cv Monlis were de-hulled with an Otake FC4S thresher Satake Japan dehulling was not required for the free-threshing bread wheat cv Serio and Blasco. WholemealflourswereproducedusingaCyclotec1093labmill FOSSTecatorDenmarkwhiteflourswereobtainedusingaBona- GBR lab mill Monza Italy that separates white flour from bran and shorts. The white flour recovery rate was 60.9 58.6 and 55.8 for Monlis Serio and Blasco respectively. All flours were put in 500mL glass bottles with screwcaps and placed underdarkness in refrigerated cells Igloo Italy for storage at 20 1.5 Cand5 1.5 CandinthermostatcabinetsHeraeus Germany for storage at 20 1 C 30 1 C and 38 2 C. The storage was maintained up to 374 days. 2.3. Analytical methods The following determinations were performed on whole meal and white flours: dry mattercontent method 44-15 AACC1994 SDS sedimentation volume following the procedure described by Preston et al. 1982 with minor modifications falling number method56-81BAACC1994alpha-amylaseactivitymethod22- 02 AACC1994 using the Ceralpha assay kit Megazyme Interna- tional Ireland Ltd. Bray Ireland amylose determined with the MegazymeamyloseassaykitMegazymeInternationalIrelandInc. Bray Ireland. Alpha-amylase activity was measured in Ceralpha Units CU: one CU is defined as the amount of enzyme in the presence of excess a-glucosidase and glucoamylase required to release one micromole of p-nitrophenol from BPNPG7 in one minute under the defined assay conditions. The pasting behaviour of starches during gelatinisation was assessedwith a Rapid ViscoAnalyzerRVA Newport Scientific Pty. Ltd. Warriewood NSW Australia. Briefly whole meal flour 4.0g based on 14 moisture or white flour 3.5g based on 14 moisture was dispersed with 25ml of distilled water in an aluminium canister. With constant stirring the flour-water suspensionwas held at 50 C for 1minheatedto95 C over 3min 45smaintainedat95 Cfor2min30sandprogressivelycooledto 50 C over 3min 45s. The starch viscosity parameters measured were peak viscosity breakdown final viscosity setback peak time and pasting temperature. All measurements were performed twice amylose content three times the results are presented as means of the measurements. 2.4. Kinetics modelling To determine the reaction order of alpha-amylase inactivation zero- and first-order kinetics were hypothesised by applying the general reaction rate expression –dC/dt¼kC n where C is the enzymatic activity k is the reaction rate constant t is the reaction timeand nistheorderofthereactionAtkinsandDePaula2006. Theorderwiththebestcorrelationrandthebestcorrespondence among the experimental values and the half-life of the compound t 1/2 i.e. the time for the residual enzymatic activity to fall to half itsinitialvaluewheret 1/2 ¼C 0 /2kforzeroorderandC 0 istheinitial activity t 1/2 ¼ln2/k for first order was selected. Thereactionratetotemperaturerelationshipwasquantifiedby the Arrhenius equation lnk¼lnk 0 Ea/RT where Ea is the acti- vation energy of the reaction kJ/mol lnk 0 is the pre-exponential constant R is the gas constant 8.314J/mol/K and T is the mean absolutetemperatureof the consideredstoragetemperaturerange K.FromtheslopeoftheArrheniuslinethezvaluez¼2.303 RT 2 / Ea was computed: z represents the increase in temperature that causes a 10-fold rise in the reaction rate. Kinetics data were analysed by regression analysis using Microsoft Excel 2000. 3. Results and discussion 3.1. Flour parameters Table 1 reports moisture content alpha-amylase falling numberamyloseRVAparametersandSDSsedimentationvaluesin freshly milled whole meal and white flours of einkorn cv Monlis bread wheat cv Serio and bread wheat cv Blasco. The alpha-amylase activity was slightly higher in whole meal flours than in white flours however the difference was statisti- callysignificantonlyforMonlis.Wholemealflourstendtopresent higher alpha-amylase activity because this enzyme is particularly abundant in the external layers of the kernel Rani et al. 2001 einkorn has smaller kernels and higher bran percentage than bread wheat Hidalgo and Brandolini 2008b thus further Table 1 Pre-storage technological characteristics mean values s.d. of flours from einkorn cv Monlis and bread wheat cvs Serio and Blasco. Monlis Serio Blasco Whole meal White flour Whole meal White flour Whole meal White flour Moisture g/100g 9.4 0.05 10.4 0.05 9.2 0.01 11.0 0.01 9.4 0.12 11.0 0.21 Alpha-amylase CU 0.242 0.008 0.184 0.010 0.212 0.013 0.202 0.014 0.356 0.021 0.344 0.018 Falling number s 346 8.5 387 5.0 349 2.1 329 9.2 216 1.4 218 5.0 Amylose g/100g starch 25.2 0.73 25.1 1.02 24.8 0.91 25.0 1.21 25.3 1.08 25.0 0.65 Peak viscosity cP 2721 11.3 2534 8.5 1510 29.7 1420 23.3 674 4.2 803 18.4 Through cP 1519 24.7 1402 3.5 926 2.1 762 8.5 231 5.0 248 5.0 Breakdown cP 1203 13.4 1133 5.0 585 31.8 658 14.8 444 9.2 556 13.4 Final viscosity cP 2629 35.4 2468 18.4 1837 44.5 1495 33.2 548 1.4 577 14.8 Setback cP 1110 10.6 1067 14.8 911 46.7 733 24.7 318 3.5 339 9.9 Peak time min 6.07 0.000 6.10 0.047 5.62 0.000 5.77 0.042 4.90 0.042 4.97 0.049 Peak temperature C 63.7 0.04 62.4 0.60 62.9 0.64 61.3 0.00 61.7 0.64 61.7 0.64 SDS ml 29 1.4 71 0.7 46 0.0 72 2.8 43 3.5 65 0.0 A. Brandolini et al. / Journal of Cereal Science 51 2010 205–212 206

slide 34:

increasing enzymatic activity in whole meal with respect to white flour. On the other hand Blasco showed signs of partial pre- germination with moderately high alpha-amylase contents 0.356 and 0.344 CU for whole meal and white flour respectively and somewhatlowfalling numbervalues 216 and 218s. Thestatus of Blasco was confirmed by the results of the RVA analysis because while Monlis and Serio presented normal pasting profiles its flours showed reduced peak and final viscosities coupled with steep breakdowns. While the trends were similar no direct comparison between whole meal and white flour RVA results are possible because of the different substrate quantities 4.0 and 3.5g used in the analyses. No significant differences were observed among Monlis Serio and Blasco or between flour type for amylose content that was always around 25g/100g starch. On the other hand the SDS sedimentation volume of the white flours on average 69.3 2.19mlwassignificantlyhigherthanthatofthewholemeal flours 39.3 5.24ml because bran does not contribute to gluten swelling. 3.2. Alpha-amylase The evolution of alpha-amylase activity during the storage of wholemealandwhitefloursatdifferenttemperaturesispresented 0.06 0.10 0.14 0.18 0.22 0.26 0.30 0.34 0.38 0 100 200 300 400 Time days α -amylase activity CU Serio flour 0.06 0.10 0.14 0.18 0.22 0.26 0.30 0.34 0.38 0 100 200 300 400 Time days α -amylase activity CU Monlis wholemeal flour 0.06 0.10 0.14 0.18 0.22 0.26 0.30 0.34 0.38 0 100 200 300 400 Time days α -amylase activity CU Serio wholemeal flour 0.06 0.10 0.14 0.18 0.22 0.26 0.30 0.34 0.38 0 100 200 300 400 Time days α -amylase activity CU Monlis flour 0.06 0.10 0.14 0.18 0.22 0.26 0.30 0.34 0.38 0 100 200 300 400 Time days α -amylase activity CU 38°C 30 20 5 -20 Blasco flour 0.06 0.10 0.14 0.18 0.22 0.26 0.30 0.34 0.38 0 100 200 300 400 Time days α -amylase activity CU 38°C 30 20 5 -20 Blasco wholemeal flour Fig.1. Isothermaldegradationkineticsofalpha-amylaseactivityduringthestorageofwholemealandwhiteflourfromeinkorncvMonlisbreadwheatcvSerioandbreadwheatcv Blasco. The points represent experimental mean values the lines follow the zero order kinetics equation C¼C 0 kt. A. Brandolini et al. / Journal of Cereal Science 51 2010 205–212 207

slide 35:

inFig.1.Inallsamplesalpha-amylaseactivitydecreasedtovarious extentsduringstorage.Thedeclinewasabsentornegligibleat 20 and 5 C but increasingly stronger at higher temperatures: for example after 374 days at 38 C alpha-amylase activity dropped on average 50.6 35.6 and 28.5 for Monlis Serio and Blasco respectively marginal differences were observed between whole meal and white flours. Rehman and Shah 1999 in whole meal flourfromwheatkernelsstoredat1025and45 Coversixmonths observed decreases of 9.2 21.6 and 34.0 respectively. In the unsprouted wheats the alpha-amylase inactivation reaction followed a zero order kinetics C¼C 0 kt for both flour types in Monlis and Serio high regression coefficients 0.93–0.99 and good correspondence between experimental values and calculated half-life time especially at higher temperatures were observed. The alpha-amylase activity of pregerminated wheat Blascoshowedalineardecreaseonlyinthefirst100daysofstorage followedbyagradualreductionoftheslopedowntoaplateauthus leading to an asymptotic inactivation trend. The sometimes reduced r values at 5 e 20 C were a consequence of random experimental errors on trends with minimal fluctuations. During storage alpha-amylase activity decreased as a function of temperature and time the reaction rate constant k increased as the temperature augmented indicating a quicker degradation of thecompoundsat highertemperatures.In theunsproutedwheats 200 300 400 500 600 700 800 900 1000 0 100 200 300 400 Time days Falling number s Serio flour 200 300 400 500 600 700 800 900 1000 0 100 200 300 400 Time days Falling number s Monlis wholemeal flour 200 300 400 500 600 700 800 900 1000 0 100 200 300 400 Time days Falling number s Monlis flour 200 300 400 500 600 700 800 900 1000 0 100 200 300 400 Time days Falling number s Serio wholemeal f 200 400 600 800 1000 0 100 200 300 400 Time days Falling number s 38°C 30 20 5 -20 Blasco wholemeal flour 200 300 400 500 600 700 800 900 1000 0 100 200 300 400 Time days Falling number s 38°C 30 20 5 -20 Blasco flour Fig.2. Variation of falling numberduring thestorageofwhole meal andwhiteflour fromeinkorncv Monlis breadwheat cv Serio andbreadwheat cv Blasco. Thepoints represent experimental mean values the best interpolation curve is shown. A. Brandolini et al. / Journal of Cereal Science 51 2010 205–212 208

slide 36:

rate constants were similar between flours but different between species as they were higher in Monlis on average k¼ 0.292 0.0078 10 3 CU days 1 at 38 C than in Serio k¼ -0.193 0.0062 10 3 . The Arrhenius model was used to determine the influence of temperatureonthereactionratekforMonlisandSeriofloursthe average activation energies in Monlis and Serio were 50.6 1.27 and47.5 3.13kJ/molrespectivelywithzvaluesof31.3 0.78and 33.5 2.20 C and pre-exponential constants of 11.13 0.37 and 9.50 1.19. The overall variation of the Arrhenius parameters considering the complex substrate analysedwas minimal. It is not possible to compare these results with literature information because while several studies on inactivation kinetics of alpha- amylase in different systems are available e.g. Apar and O ¨ zbek 2004Kumaretal.2005RiahiandRamaswamy2004Tanakaand Hoshino 2002 to the best of our knowledge no data on stored flours exist. 3.3. Falling number The falling number variation during storage at different temperaturesofwholemealandwhitefloursisdepictedinFig.2.In all cases falling number values increased during storage: the improvementwasminimalatlowtemperaturesbutwasrelevantat 400 1200 2000 2800 3600 4400 0 100 200 300 400 Time days Final viscosity cP Monlis flour 400 1200 2000 2800 3600 4400 0 100 200 300 400 Time days Final viscosity cP Monlis wholemeal flour 400 1200 2000 2800 3600 4400 0 100 200 300 400 Time days Final viscosity cP Serio flour 400 1200 2000 2800 3600 4400 0 100 200 300 400 Time days Final viscosity cP 38°C 30 20 5 -20 Blasco flour 400 1200 2000 2800 3600 4400 0 100 200 300 400 Time days Final viscosity cP Serio wholemeal flour 400 1200 2000 2800 3600 4400 0 100 200 300 400 Time days Final viscosity cP 38°C 30 20 5 -20 Blasco wholemeal flour Fig. 3. Changes of RVA final viscosity during the storage of whole meal and white flour from einkorn cv Monlis bread wheat cv Serio and bread wheat cv Blasco. The points represent experimental mean values the best interpolation curve is shown. A. Brandolini et al. / Journal of Cereal Science 51 2010 205–212 209

slide 37:

30andparticularlyat38 C.Atthistemperaturethemeanincrease rangedfrom56to70inwholemealfloursandfrom89to176in whiteflourstheleastdifferencebetweenflourtypeswasobserved in the pregerminated Blasco sample. These data are in goodagree- ment with those reported by Meredith and Simmons 1975 who examinedfourbreadwheatsstoreduptoeightyearsandobserved anincreaseoffallingnumberthroughouttheageingprocess. Falling number and alpha-amylase activity are strongly corre- lated parameters: alpha-amylase hydrolyses a-14-glucosidic linkages thus degrading starch and reducing gel strength measured by the falling number test Lunn et al. 2001. 3.4. RVA parameters RVA profiles of whole meal and white flours during storage at 38 C are presented as Supplementary Fig.1: the upwards shift of the RVA curves clearly points to a change in pasting properties during flour ageing. This result is evident also in Fig. 3 which 20 30 40 50 60 70 80 90 100 0 100 200 300 400 Time days SDS volume mL Serio flour 20 30 40 50 60 70 80 90 100 0 100 200 300 400 Time days SDS volume mL Monlis wholemeal flour 20 30 40 50 60 70 80 90 100 0 100 200 300 400 Time days SDS volume mL Monlis flour 20 30 40 50 60 70 80 90 100 0 100 200 300 400 Time days SDS volume mL Serio wholemeal flour 20 30 40 50 60 70 80 90 100 0 100 200 300 400 Time days SDS volume mL 38°C 30 20 5 -20 Blasco wholemeal flour 20 30 40 50 60 70 80 90 100 0 100 200 300 400 Time days SDS volume mL 38°C 30 20 5 -20 Blasco flour Fig. 4. Evolution of SDS sedimentation volume during the storage of whole meal and white flour from einkorn cv Monlis bread wheat cv Serio and bread wheat cv Blasco. The points represent experimental mean values the best interpolation curve is shown. A. Brandolini et al. / Journal of Cereal Science 51 2010 205–212 210

slide 38:

depicts the variation of final viscosity at the different storage temperatures. In all flour samples with the exception of Monlis flour the viscosity increased with a hyperbolic trend reaching a plateau during the late storage stage. The variation was strongly temperature-dependent.Theincreasedratesweresimilarbetween flour types however they were different between accessions because they were lower in Monlis on average 47.6 13.3 at 38 C than in Serio 129.7 2.5 and in pregerminated Blasco 366.1 47.2. Similar trends were observed for other relevant RVA parameters i.e. peak viscosity breakdown setback and peak time not shown. Theeffectofstorageonpastingtemperaturesofwheatflourhas been sparingly explored in the past. Loney and Meredith 1974 described an increase in peak amylograph viscosity during natural 15–20 C and accelerated 50 C storage of commercial flours controls kept at 25 C on the other hand did not change. For flours stored at 50 C during one year peak viscosity reached aplateauafter20weeksthendeclinedandafter40–50weekswas similartotheoriginalvalue.SalmanandCopeland2007observed that peak and final viscosity of whole meal wheat flours stored up to 12 months at 20 and 30 C increased significantly with storage time compared with samples kept at 4 C the rise was correlated positively with a growth in fat acidity. Ageing experiments carried out in rice summarised in Zhou et al. 2002 indicate that rice paste viscosity increases consider- ably during storage the effect is more pronounced at higher temperatures 29 C than at lower 2 C. Some months after the initial increase in peak and final viscosity a plateau is sometimes observedTeoetal.2000overstoragetimeslastingseveralyears a steady decrease during the latter part of the ageing period is described Sawbhagya and Bhattacharya 2001. The ageing effect on viscosity has been variously attributed to cell wall structure decomposition Shibuya and Iwasaki 1984 modification of the proteins Teo et al. 2000 increases in soluble protein content particularly the high molecular weight glutenin fraction Wilkes and Copeland 2008 changes in free fatty acids amount Salman and Copeland 2007 or in starch characteristics Loneyand Meredith1974. Oneof thetraitsanalysedinthisresearchwasamylosecontent as percentage of total starch. However amylose did not vary significantly during storage even at 38 C data not presented therefore suggesting that it does not influence the variation of pastingvaluesduringflourageing.Astablecontentoftotalamylose in wheat grain stored at 10 25 and 45 C over six months was observed also by Rehman and Shah 1999. 3.5. SDS sedimentation The variation of SDS sedimentation during the ageing of whole meal and white flour is presented in Fig. 4. At high temperatures a general trend for all samples was an initial increase in sedimen- tation values followed by a rapid decline while at low tempera- tures the improvement was slower but more pronounced and longer lasting. The maximum sedimentation volume was reached after different times depending on the storage temperature: for exampleinwholemealfloursstoredat38 Cthepeakonaverage was after 28 days but it shifted gradually to 49 30 C 72 20 C 128 5 C and 203 days 20 C. At the end of the ageing period the flours stored at 20 5 and 20 Cmaintainedorimprovedtheirinitialperformancewhilethe bread wheat flours stored at higher temperatures had SDS sedi- mentationvalues largelylower thantheir initialvalue on average at38 CSeriosedimentationvaluedecreased26.8 5.10andBlasco 35.8 5.65. A different trend was observed for Monlis: after reaching a maximum SDS values of whole meal and white flour decreased but even after being stored at 38 C for 374 days were higher than the initial values by 37.9 and 7 respectively. The awareness of SDS sedimentation evolution during storage may havearelevantimpactonflourutilisationpatternin breadmaking suggesting the best employment periods for optimal results. Ephrat and Sinmena 1976 reported a decrease of values in wheatswithhighinitialsedimentationstoredat302011and3 C however they observed relevant genotypic differences in the sedi- mentationvaluedynamicsandnodecreasewasobservedincultivars withlowinitialvalues.Highstoragetemperatureshadamuchmore pronounced effect than lower temperatures. On the other hand Nishio et al. 2004 examining breadmaking quality improvement duringflourshort-termageingeightweeksdescribedanincrease in farinographic stability up to two weeks after milling and in specificloafvolumeuptofourweeksaftermilling. The SDS sedimentation test evaluates the breadmaking quality ofthefloursbreadmakingandglutenqualityaremainlyrelatedto storage protein content and composition Taenzler et al. 2002. Wilkes and Copeland 2008 studying protein changes in wheat kernelsstoredat4 Cand30 Cfor270daysobservedasignificant increase in soluble protein content of the samples kept at higher temperature. Protein profiling and identification revealed that the most evident change was an increase in the content of high molecular weight glutenin subunits in the soluble fraction. Storing wheat flours at temperatures 20 C is recommended to better preserve their breadmaking performance moreover conservation improves to some extent the quality of slightly pre- germinated flours. Acknowledgements This research was financially supported by project n. 1018 ‘‘MonICA-Monococco per l’innovazione agricola e colturale’’ sponsored by the Regione Lombardia Italy. Appendix. Supplementary information Supplementary Fig. 1. RVA profiles of whole meal and white flour from einkorn cv Monlis bread wheat cv Serio and bread wheat cv Blasco whole meal flours during storage at 38 C. The pasting profiles shift upwards with increasing storage times. Note: Supplementary material associated with this article can be found in the online version at doi:10.1016/j.jcs.2009.11.013. References AACC – American Association of Cereal Chemists1994. AACC Official Methods 22- 0244-15 56-81B. In:ApprovedMethods of theAmerican Associationof Cereal Chemists Minneapolis USA. AbdelAalE.S.M.YoungJ.C.WoodP.J.RabalskiI.HuclP.FalkD.Fre ´geau-ReidJ. 2002. Einkorn: a potential candidate for developing high lutein wheat. Cereal Chemistry 79 455–457. Apar D.K. O ¨ zbek B. 2004. a-amylase inactivation by temperature during starch hydrolysis. Process Biochemistry 39 1137–1144. Ariyama T. Khan K. 1990. Effect of laboratory sprouting and storage on physico- chemical and breadmaking properties of hard red spring wheat. Cereal Chemistry 67 53–58. Atkins P. De Paula J. 2006. The rates of chemical reactions. In: Atkins’ Physical Chemistry eighth ed. Oxford University Press Oxford UK pp. 791–823. Bailey J.E.1992. Whole grain storage. In: Sauer D.B. Ed. Storage of Cereal Grains and their Products fourth ed. American Association of Cereal Chemists Inc. St. Paul Minnesota pp.157–182. Borghi B. Castagna R. Corbellini M. Heun M. Salamini F. 1996. Breadmaking quality of einkorn wheat Triticum monococcum ssp. monococcum. Cereal Chemistry 73 208–214. Brandolini A. Hidalgo A. Moscaritolo S. 2008. Chemical composition and pasting propertiesofeinkornTriticum monococcum L.subsp. monococcumwholemeal flour. Journal of Cereal Science 47 599–609. A. Brandolini et al. / Journal of Cereal Science 51 2010 205–212 211

slide 39:

Castagna R. Borghi B. Di Fonzo N. Heun M. Salamini F.1995. Yield and related traits of einkorn Triticum monococcum ssp. monococcum in different envi- ronments. European Journal of Agronomy 4 371–378. Catterall P. 1998. Flour milling. In: Cauvain S.P. Young L.S. Eds. Technology of Breadmaking. Chapman Hall New York pp. 296–316. CenkowskiS.DexterJ.E.ScanlonM.G.2000.Mechanicalcomparisonofflour:the effect of storage temperature on dough rheological properties. Canadian Agricultural Engineering 42 33–41. Chen X. Shofield J.D. 1996. Changes in the glutathione content and breadmaking performanceofwhitewheatflourduringshorttermstorage.CerealChemistry731–4. CorbelliniM.EmpilliS.VaccinoP.BrandoliniA.BorghiB.HeunM.SalaminiF. 1999. Einkorn characterization for bread and cookie production in relation to protein subunit composition. Cereal Chemistry 76 727–733. Edwards W.P. 2007. The Science of Bakery Products. The Royal Society of Chemistry Cambridge UK. EphratJ.SinmenaB.1976.Storagedurationandtemperatureandwheatgenotype effect on sedimentation value. Agronomy Journal 68 27–30. FAO. 2007. http://faostat.fao.org. Hidalgo A. Brandolini A. 2008a. Kinetics of carotenoids degradation during the storage of einkorn Triticum monococcum L. ssp. monococcum and breadwheat Triticum aestivum L. ssp. aestivum flours. Journal of Agricultural and Food Chemistry 56 11300–11305. Hidalgo A. Brandolini A. 2008b. Protein ash lutein and tocols distribution in einkorn Triticum monococcum L. subsp. monococcum seed fractions. Food Chemistry 107 444–448. Hidalgo A. Brandolini A. Pompei C. 2009. Kinetics of tocols degradation during the storage of einkorn Triticum monococcum L. ssp. monococcum and bread- wheat Triticum aestivum L. ssp. aestivum flours. Food Chemistry 116 821–827. Hidalgo A. Brandolini A. Pompei C. Piscozzi R. 2006. Carotenoids and tocols of einkorn wheat Triticum monococcum ssp monococcum L.. Journal of Cereal Science 44182–193. Hruskova M. Machova D. 2002. Changes of wheat flour properties during short term storage. Czech Journal of Food Science 20 125–130. KumarR.S.S. Singh S.A. Appu RaoA.G. 2005. Thermal stabilityofa-amylasefrom malted jowar Sorghum bicolor. Journal of Agricultural and Food Chemistry 53 6883–6888. Loney D.P. Meredith P.1974. Note on amylograph viscosities of wheat flours and their starches during storage. Cereal Chemistry 51 702–706. Lunn G.D. Kettlewell P.S. Major B.J. Scott R.K. 2001. Effects of pericarp alpha- amylase activity on wheat Triticum aestivum Hagberg falling number. Annals of Applied Biology 138 207–214. Meredith P. Simmons L.D. 1975. Falling number and amylographic viscosity of wheat flour made from grain stored for several years. New Zealand Journal of Science 18185–188. Nishio Z. Tanaka K. Ito M. Tabiki T. Iriki N. Funatsuki W. Yamauchi H. 2004. Relationship between physical dough properties and the improvement of bread-making quality during flour ageing. Food Science and Technology Research 10 208–213. Pomeranz Y. 1992. Biochemical functional and nutritive changes during storage. In: Sauer D.B. Ed. Storage of Cereal Grains and their Products fourth ed. American Association of Cereal Chemists Inc. St. Paul Minnesota pp. 55–141. Preston K.R. March P.R. Tipples K.H. 1982. An assessment of the SDS sedimen- tationtestforthepredictionofCanadianbreadwheatquality.CanadianJournal of Plant Science 62 545–553. Rani K.U. Prasata Rao U.J.S. Leelavathi K. Aridas Rao P. 2001. Distribution of enzymes in wheat flour mill stream. Journal of Cereal Science 34 233–242. Rehman Z.U. Shah W.H. 1999. Biochemical changes in wheat during storage at three temperatures. Plant Foods for Human Nutrition 54109–117. Riahi E. Ramaswamy H.S. 2004. High pressure inactivation kinetics of amylase in apple juice. Journal of Food Engineering 64 151–160. Salman H. Copeland L. 2007. Effect of storage on fat acidity and pasting charac- teristics of wheat flour. Cereal Chemistry 84 600–606. Sawbhagya C.M. Bhattacharya K.R. 2001. Changes in pasting behaviour of rice during ageing. Journal of Cereal Science 34115–124. ShelkeK.HoseneyR.C.FaubionJ.M.CurranS.P.1992.Age-relatedchangesinthe propertiesof battersmade fromflour milled fromfreshly harvestedsoft wheat. Cereal Chemistry 69 145–147. Shibuya N. Iwasaki T.1984. Effect of cell wall degrading enzymes on the cooking properties of milled rice and the texture of cooked rice. Journal of the Japanese Society of Food Science and Technology 31 656–660. Taenzler B. Esposti R.F. Vaccino P. Brandolini A. Effgen S. Heun M. Scha ¨fer- Pregl R. Borghi B. Salamini F. 2002. A molecular linkage map of einkorn wheat: mapping of storage-protein and soft-glume genes and bread making QTLs. Genetical Research 80131–143. Tanaka A. Hoshino E. 2002. Calcium-binding parameter of Bacillus amylolique- faciens a-amylase determined by inactivation kinetics. Biochemistry Journal 364 635–639. Teo C.H. Abd-Karim A. Chea P.B. Norziah M.H. Seow C.C. 2000. On the roles of proteins and starch in the aging of non-waxy rice flour. Food Chemistry 69 229–236. Tipples K.H. 1995. Quality and nutritional changes in stored grain. In: Jayas D.S. White N.D.G. Muir W.E. Eds. Stored Grain Ecosystems. Marcel Dekker New York pp. 325–352. Wang L. Flores R.A. 1999. The effects of storage on flour quality and baking performance. Food Review International 15 215–234. Wilkes M. Copeland L. 2008. Storage of wheat grains at elevated temperatures increases solubilization of glutenin subunits. Cereal Chemistry 85 335–338. Zhou Z. Robards K. Helliwell S. Blanchard C. 2002. Composition and functional properties of rice. International Journal of Food Science Technology 37 849–868. A. Brandolini et al. / Journal of Cereal Science 51 2010 205–212 212

slide 40:

Biodegradable films based on rice starch and rice flour Amanda B. Dias Carmen M.O. Mu ¨ller Fa ´bio D.S. Larotonda Joa ˜o B. Laurindo Federal University of Santa Catarina Department of Chemical and Food Engineering PO Box 476 Florianopolis-SC Brazil 88040-900 article info Article history: Received 31 July 2009 Received in revised form 19 November 2009 Accepted 28 November 2009 Keywords: Rice Starch Flour Films abstract Rice flour is a starchy material with low-cost because it can be produced fromrice that is broken during processing. The aim of this study was to develop biodegradable films based on rice starch and rice flour andtocharacterizetheir physicochemicalmicroscopic andmechanicalproperties.Filmsfromricestarch andriceflourwerepreparedbycastingwithglycerolorsorbitolasplasticizer.SEManalysisofstarchand flour films revealed compact structures. Rice flour films prepared in the present work have similar mechanical properties to those of starch based films. However their water vapor permeabilities are two timeshigherthanthoseofstarchbasedfilms.Filmswithsorbitolwerelesspermeabletowaterandmore rigid while films with glycerol are more plasticized and have poorer water vapor barrier properties. Thereforepreparingedible films fromrice flour is anewalternative for using thisraw material which is sometimes much cheaper than commercial starches. 2009 Elsevier Ltd. All rights reserved. 1. Introduction One of the matters of great concern nowadays is the environ- mentalimpactcausedbytheexcessivequantityofnon-degradable waste materials discarded every day. This reality has been stimu- lating research to develop new biodegradable packaging materials that could be considered environmentally friendly raw materials Ave ´rous et al. 2001. Among these materials the ones derived from renewable resources which participate in the carbon cycle has received more attention since they combine environmental benefits and sustainability. The production of biodegradable and edible films from carbo- hydratesandproteinsaddsvaluetolow-costrawmaterialsandcan play an important role in food preservation Ave ´rous et al. 2001 Krochta and Miller1997 among others. Several studies reported the use of starches from different sources to prepare films and coatings with different properties and have indicated that these carbohydratesarepromisingmaterialsinthisregardAve ´rousetal. 2001 Larotonda et al. 2005 Mali et al. 2005. Few studies have reported in the last decade about the use of flour as raw materials suitable for preparing films. The interest in combining polysaccharides proteins and lipids is due to the advantagesanddisadvantagesofthesecomponentsBaldwinetal. 1995. The use of natural blends of protein polysaccharides and lipids directly obtained from agricultural sources takes advantage of each component in the original systemand appears to be a new opportunity for material in the area of edible films Tapia-Bla ´cido et al. 2005. Rayas and Herna ´ndez 1997 prepared edible films from three types of wheat flours and more recently Mariniello et al. 2003 used whole soy flour and apple pectin Tapia-Bla ´cido etal. 2005 and Colla etal. 2006 used amaranth flouras the raw materials for producing edible films. Rice flour can be considered such a natural mixture and consequently a suitable raw material for preparing edible or biodegradable films. Rice Oryza sativa L. is the principal staple food for half the world’s population Hagenimana et al. 2006. Starch is the major chemical component of cereal grains comprisingaround 90of the dry weightof rice grain. Protein and lipid contents are also significant being about 6.5 and 0.8 respectivelyZhouetal.2002.Theaimofthisworkwastoprepare films based on rice starch and rice flour and compare their physi- cochemical microscopic and mechanical properties. 2. Materials and methods 2.1. Materials RicestarchwasextractedfromgrainsofwhitericeO.sativabythe alkalinemethodproposedbyYamamotoetal.1973customizedby Lumdubwong and Seib 2000. Rice flour Amitec A-100 was Abbreviations: a w water activity b solubility coefficient of water in the film g water/g dry solid.Pa D w diffusion coefficient of water in the film m 2 /s 3 elon- gation at break GAB model Guggenheim–Anderson–de Boer model K w water vapor permeability g/h.m.Pa r S density g/cm 3 SEM scanning electron microscopy T tensile strength MPa Y Young modulus MPa. Corresponding author. Tel.: þ55 48 37215229 fax: þ55 48 37219687. E-mail address: joaoenq.ufsc.br J.B. Laurindo. Contents lists available at ScienceDirect Journal of Cereal Science journal homepage: www.elsevier.com/locate/jcs 0733-5210/ – see front matter 2009 Elsevier Ltd. All rights reserved. doi:10.1016/j.jcs.2009.11.014 Journal of Cereal Science 51 2010 213–219

slide 41:

provided bythecompany JosaparS.A. PelotasRS Brazil. Glycerol andsorbitolwerepurchasedfromNuclearSa ˜oPauloBrazil. Chemical analyses were performed to determine the chemical compositionof thestarchextractedfromriceandforthericeflour. Themethodologiesusedwere:aKjeldahlmethodfordetermining protein content using the value 6.25 as the nitrogen-to-protein conversion factor AOAC1996 b to determine the lipid content Soxhlet extraction method was used for lipid content determina- tion with petroleum ether as solvent boiling point 40–60 C and the minimum extraction time of 36 hours AOAC 1996 c dry incinerationmethodat550 CtodeterminetheashcontentAOAC 1996dovendesiccationat105 2 Ctodeterminethemoisture AOAC1996 e carbohydrates content was determined by differ- ence from the contents of the others components. 2.2. Film preparation Rice starch and rice flour films were prepared by a casting technique. Glycerol and sorbitol were used as plasticizers at concentrations of 0.20 and 0.30 g/g dry raw material starch or flour. Aqueous solutions containing 5 of raw material starch or flourwerepreparedandstirredfor15minat4000rpm.Plasticizer was added to the aqueous solution and the mixture was heated to 85 C in a thermal bath under constant stirring during 1 h to promotethestarchgelatinizationandpouredhomogeneouslyonto plexiglass plates and dried at 30 C for 14 h in an oven with circulating air. For preparation of rice flour films the pH of the aqueous solutionwas adjusted to 10.0 with NaOH solution 0.1 N in order to promote protein solubilization. Films plasticized with glycerol were codified as SG starch based films and FG flour basedfilmsandtheonesplasticizedwithsorbitolwerecodifiedas SS starch based films and FS flour based films followed by the corresponding amount of plasticizer. For example SG20 and FS30 were the formulations with rice starch film with 0.20 g glycerol/g starch and rice flour filmwith 0.30 g sorbitol/g flour respectively. 2.3. Film characterization 2.3.1. Scanning electron microscopy SEM Scanning electron microscopy SEM of film samples was obtained using a Philips XL-30 scanning electron microscope. The samples were coated with a fine gold layer before obtaining the micrographs. All samples were examined using an accelerating voltage of 10 kV. Micrographs of drying exposed surface and frac- ture cryofracture of films plasticized with 0.3 g of plasticizer/g of raw material were carried out. 2.3.2. Density Prior to film properties determination samples were condi- tioned at 25 C and 58 relative humidity RH for 48 h. Films thicknesses were measured exactness of 0.001 mm using aDigimaticdigitalexternalmicrometerMitutoyoCo.Japanatten differentpointsofthefilm.Fordeterminingfilmdensitysamplesof 2 2 cm were maintained in a desiccator with phosphorus pent- oxide 0 RH for 20 days and weighed. Thus dry matter densities were calculated by Eq. 1. r S ¼ m A d 1 where A is the film area 4 cm 2 d the film thickness cm m the film dry mass g and r S the dry matter density of the film g/cm 3 Larotonda et al. 2005. The film density was expressed as the average of ten determinations. 2.3.3. Moisture sorption isotherms Film moisture sorption isotherms were determined at 25 Cby the static method using saturated saline solutions to obtain different relative humidities Bell and Labuza 2000. The Gug- genheim–Anderson–de Boer GAB model Eq. 2 was used to represent the experimental equilibrium data. In this equation the parameterX w istheequilibriummoisturegwater/gdrymassm 0 is the monolayer water content C is the Guggenheim constant which represents the sorption heat of the first layer and k is the sorption heat of the multilayers. GAB model parameters were determined by non-linear regression using Statistica Software 6.0 Statsoft USA. X W ¼ Ckm 0 a w ð1 ka w Þð1 ka w þCka w Þ 2 2.3.4. Water vapor permeability K w Film water vapor permeabilities K w were determined in appropriate diffusion cells Saranto ´poulos et al. 2002 using a relative humidity gradient of 2–75. Water vapor permeability was determined using Eq. 3. K w ¼ Wd Sp s ða w1 a w2 Þ 3 where distheaveragefilmthickness Sisthefilmpermeationarea 0.005m 2 a w1 75isthewateractivityinthechamber a w2 2 isthewateractivityinsidethecellp s isthewatervaporpressureat the experimental system temperature 25 C and W ¼ G/t g of water/hour was calculated using the linear regression of mass variation over time under steady state permeation condition. 2.3.5. Solubility b and diffusion D w coefficients of water in the films The solubility coefficients of water in the films b were deter- minedaccordingtoLarotondaetal.2005bythefirstderivativeof the film’s moisture sorption isotherm GAB model in relation to the water activity a w divided by the water vapor pressure p s at the sorption isotherm temperature. Physically the coefficient b is thepartitioncoefficientofwaterbetweenairandfilmandisgiven by Eq. 4. where Cm 0 andkaretheadjustparametersoftheGABmodeland b is given in g of water/g of dry solid Pa. The water diffusion coefficients through the films D w can be determined from water vapor permeability K w solubility coeffi- cient of water in the film b and density of the film r S Eq. 5. K w ¼ r S bD w 5 Comparing Eq. 3 with Eq. 5 D w can be given by Eq. 6.As b varies with a w the b values corresponding to a w2 ¼ 0.02 and to a w1 ¼0.75 are calculated by Eq. 4. b ¼ Ckm 0 p s 2 6 6 4 1 ð1 ka w Þð1 ka w þCka w Þ a w ð1 ka w Þð1 ka w þCka w Þ 2 ½ kð1 ka w þCka w Þþð1 ka w Þð kþCkÞ 3 7 7 5 4 A.B. Dias et al. / Journal of Cereal Science 51 2010 213–219 214

slide 42:

D w ¼ Wd r S Sp s ðb 1 a w1 b 2 a w2 Þ 6 2.3.6. Mechanical properties MechanicaltestswerecarriedoutusingaTA-XT2itextureanalyzer Surrey–England.Thedimensionsoffilmsamplesusedintestswere 25mm 100mmcutwithsharpscissors.Priortomechanicaltests sampleswereconditionedat25 Cand58RHfor72h. Tensile strength T elongationat break3 and Young modulus Y were determined from ten replicates for each film formulation in accordance with ASTM-882-00 2000. Samples were clamped between grips and force and deformation were recorded during extensionat0.8mm/swithaninitialdistancebetweenthegripsof 50 mm. 3. Results and discussion 3.1. Chemical analysis Chemical analysis showed that rice flour is a rich source of carbohydratesandiscomposedof7.74ofproteins0.87oflipids 0.72 of ash 6.10 of moisture and 90.67 of carbohydrates. Rice starch extracted in this study was composed of 0.68 of proteins 0.35ofash5.60ofmoistureand98.97ofcarbohydrates.Starch extracted from rice reached a purity of 99 with only 0.68 of Fig.1. SEMMicrographsoffilmsurfacesandfractures:aandbricestarchfilmplasticizedwithglycerolSG300.3gglycerol/gdrystarchcanddricestarchfilmplasticized with sorbitol SS30 0.3 g sorbitol/g dry starch e and f rice flour film plasticized with glycerol FG30 0.3 g glycerol/g dry flour g and h rice flour film plasticized with sorbitol FS30 0.3 g sorbitol/g dry flour. A.B. Dias et al. / Journal of Cereal Science 51 2010 213–219 215

slide 43:

proteincontent.Itcanbeobservedthatriceflourisaproductrichin carbohydrates 90 dry basis composed mostly by starch and with a significant presence of protein around 7–8 in dry basis of rice flour. These proteins influenced the films’ properties which are observed by comparing starch films and rice flour films as discussed in the following. 3.2. Scanning electron microscopy SEM Scanning electron microscopy surfaces and fractures of film samplesarepresentedinFig.1.Micrographsofthefilmsurfacesat a magnification of 200 did not show differences between the films plasticized with glycerol and sorbitol. Both glycerol and sorbitol have the same plasticizing mechanism and are small molecules if compared with amylose–amylopectin chains. Martelli et al. 2006 found important differences among the surfaces of keratin films plasticized with glycerolsorbitol and PEG4000 using a magnification of 2000 and 3000 . These higher magnification levelscannotbeusedforstarchfilmsbecauseitcandegradethem. On the other hand the surfaces of films prepared with rice flour were more irregular than those of films prepared with rice starch. For flour base films the presence of insoluble particles was observed.Theirregularitiesinthesurfaceofriceflourfilmsmaybe related to the presence of more than one macromolecule in the polymeric matrix starch protein and lipid. Fracture micrographs Fig. 1b d f h showed homogeneity of ricestarchfilmsandofriceflourfilmsections.Consideringthatrice flour films are composed of starch protein and lipid in different amounts starch being the major component it can be concluded that the dense areas of the polymeric matrix are composed of starch. The homogeneous matrix of these films is a good indicator of their structural integrity and consequently good mechanical properties would be expected Mali et al. 2002. 3.3. Density There were no significant differences among the densities of film samples at the 5 significance level by the Tukey test p0.05.Thepresenceofproteinsandlipidsinthericeflourfilms did not affect density when compared with the rice starch films. The type of plasticizer did not influence film density Table 1. These results can be explained by the high concentration of starch inthefilmsandalsobecausethemolecularpackingissimilarforall films. Density values obtained in this work were similar to the values found by Moraes 2009 who reported density values around 1.35 g/cm 3 for films composed of 3 of cassava starch. Fama ´ et al. 2009 obtained density values around 1.38 g/cm 3 for cassava starchfilmsandcassavastarch-wheatbrancomposites.Mooreetal. 2006 reported density values ranging from 0.92 g/cm 3 to 1.10 g/ cm 3 for keratin films for different glycerol concentrations. 3.4. Moisture sorption isotherms Experimentaldataformoisturesorptionisothermsofricestarch films and rice flour films plasticized with glycerol and sorbitol are presented in Fig. 2 together with the GAB model fitted for each sample.TheGABmodelparametersandcorrelationcoefficientsare presented in Table 1. The values of k 1 and the correlation coefficient r 2 0.98 showed that the GAB equation is an adequate equation for fitting experimental data for starchy films as previ- ously reported by other authors Mali et al. 2005 among others. Rice flour films and rice starch films plasticized with the same concentration of glycerol presented similar equilibrium moisture Fig. 2a. Films plasticized with sorbitol presented lower equilib- rium moistures when compared with the films plasticized with glycerol. This behavior has been observed by other authors Mali et al. 2005 Mu ¨ller et al. 2008 among others. According to these authors glycerol and sorbitol have similar structures because they are both straight-chain molecules. However the glycerol molecule presents higher water affinity demonstrated by absorption isotherms reported in the literature Leung1986. Moreover since sorbitol is more similar to the molecular structure of glucose units than glycerol the chances of sorbitol to interact with polymeric starch chains are higher thus sorbitol-containing films present higher intermolecular forces and show lower capacity to interact withwater.Filmspreparedwithricestarchandriceflourpresented similar water sorption isotherms even for different sorbitol concentrations 0.20 or 0.30 g/g raw material. Data presented in Table 1 showed that plasticizer content did not have a significant influence on the monolayer water content m 0 for each kind of film. Rice starch films plasticized with glycerol gave the highest values for monolayer moisture. The parameter k is the corrective constant taking into account properties of multilayer molecules. In this work films gave values of k around 0.87 similar to the values reported by Coupland et al. 2000 for whey protein films. Mu ¨ller et al. 2008 related a small variation in the parameter k when using glycerol and sorbitol at different concentrations in cassava starch films. Theparameter C Guggenheimconstant gave importantvariations.Thisparameterisrelatedtothefirstcurvature oftheGABmodelwithreducedvaluesofwateractivitywherethe experimental equilibrium moistures showed higher deviations 3.5. Influence of the solubility coefficient b and the diffusion coefficient D w of water in the films on the water vapor permeabilities K w Sinceanimportantfunctionofafoodpackagingistoavoidorat least to decrease moisture transfer between the food and the surrounding atmosphere filmwater vapor permeability should be aslowaspossibleGontardetal.1992.Watervaporpermeabilities K w are presented in Table 2. K w values ranged from 9.6 10 8 g water/h.m.Pa for the rice starch films plasticized with 0.2 g Table 1 Density values determined for the film samples and GAB model parameters for moisture sorption isotherms for the rice starch films and rice flour films plasticized with glycerol and sorbitol r 2 is the correlation coefficient. Sample Density g/cm 3 m 0 g water/g dry solid kC r 2 SG20 1.30 0.10 a 0.12 0.02 bc 0.85 0.02 ab 1.42 0.20 a 0.99 SG30 1.36 0.11 a 0.16 0.01 c 0.87 0.01 b 1.70 0.34 a 0.99 SS20 1.17 0.06 a 0.07 0.00 a 0.87 0.01 b 4.12 0.61 a 0.99 SS30 1.40 0.17 a 0.11 0.01 ab 0.82 0.02 a 1.31 0.22 a 0.99 FG20 1.24 0.08 a 0.10 0.01 ab 0.89 0.01 b 1.93 0.55 a 0.99 FG30 1.25 0.06 a 0.15 0.00 ab 0.86 0.01 b 2.50 0.66 b 0.99 FS20 1.13 0.08 a 0.08 0.01 a 0.87 0.03 ab 2.45 0.81 a 0.99 FS30 1.24 0.07 a 0.07 0.01 a 0.92 0.01 c 3.98 2.02 a 0.99 Values with the same letter at the same column are not different statistically p 0.05 by the Tukey test. A.B. Dias et al. / Journal of Cereal Science 51 2010 213–219 216

slide 44:

sorbitol/g dry starch SS20 to 63.6 10 8 g water/h.m.Pa for the rice flour films plasticized with 0.3 g glycerol/g dry flour FG30. The increase of glycerol content increases the water vapor perme- ation through the films as has been reported in the literature for other hydrophilic films Cuq et al. 1997 Laohakunjit and Noom- horm 2004 Mali et al. 2002 Mu ¨ller et al. 2008. The behavior found for starch films can be explained by the increase of film hygroscopicity represented by their higher solubility coefficients b.Whentheglycerolconcentrationwasincreasedfrom20to30g of glycerol/100 g of dry raw material the b values increased by about 40. The results reported inTable 2 did not show important differences between the diffusion coefficients of starch films preparedwith20–30gofglycerol/100gofdryrawmaterial.Onthe other hand the higher water vapor permeabilities found for flour based films can be explained by their more open structure repre- sented by the higher diffusion coefficients. LaohakunjitandNoomhorm2004determinedthewatervapor permeability of rice starch films prepared by casting plasticized with0.30gglycerol/gdrystarch.TheyreportedvaluesofK w almost four times higher than those values found for similar films in the present work. For films plasticized with sorbitol the same authors found a K w of 90.9 10 8 g/h.m.Pa eight times higher than the value of K w obtained in this work 10.9 10 8 g/h.m.Pa. It is important to note that Laohakunjit and Noomhorm used a higher 0.0 0.2 0.4 0.6 0.8 1.0 a w 0.0 0.2 0.4 0.6 0.8 1.0 X W g water / g dry solid X W g water / g dry solid SG20 SG30 FG20 FG30 a 0.0 0.2 0.4 0.6 0.8 1.0 a w 0.0 0.2 0.4 0.6 0.8 1.0 SS20 SS30 FS20 FS30 b Fig. 2. Experimental data of moisture sorption isotherms of film samples fittedwith the GAB model: a films of rice starch and rice flour plasticized with glycerolb films of rice starch and rice flour plasticized with sorbitol symbols are the experimental data and lines are the GAB fitted curves. Table 2 Water vapor permeability K w solubility coefficient b and diffusivity D w of water in the films for rice starch and rice flour films. Samples K w 10 8 g/h.m.Pa b 2 a w2 ¼ 0.02 10 5 g water/g dry solid.Pa b 2 a w2 p s g water/g dry solid b 1 a w1 ¼ 0.75 10 5 g water/g dry solid.Pa b 1 a w1 p s g water/g dry solid p s b 1 a w1 –b 2 a w2 g water/g dry solid D w 10 13 m 2 /s SG20 16.7 2.5 a 4.8 0.0030 25.7 0.6067 0.6037 1.4 SG30 31.2 0.8 b 7.6 0.0048 37.6 0.8877 0.8829 1.7 SS20 9.6 0.4 a 7.3 0.0046 16.3 0.3848 0.3802 1.3 SS30 10.9 1.3 a 3.9 0.0024 20.4 0.4816 0.4791 1.2 FG20 41.0 3.6 c 5.6 0.0035 27.6 0.6516 0.6480 3.6 FG30 63.6 6.1 d 10.4 0.0065 35.9 0.8475 0.8410 6.6 FS20 12.6 0.5 a 5.2 0.0033 18.8 0.4438 0.4406 1.6 FS30 13.9 0.1 a 7.0 0.0044 19.8 0.4674 0.4630 1.5 Values with the same letter at the same column are not different statistically p 0.05 by the Tukey test. A.B. Dias et al. / Journal of Cereal Science 51 2010 213–219 217

slide 45:

relativehumiditygradient0–90RHtodetermineK w whileinthis work the RH gradient was 2–75. However the much higher values of permeability of these films seem to be associated with their porous and irregular microstructure observed by the cited authors from SEM micrographs. Fig. 3 illustrates the behavior of the solubilitycoefficients bof water in the films showing that the values of this coefficient strongly depend on the range of the air relative humidity water activity of the film. Although few works had investigated the influence of this coefficient in the water vapor permeability of starch and protein based films Moore et al. 2006 Mu ¨ller et al. 2008 the behavior of this coefficient is determinant in the water permeation processes as discussed in the following. For films prepared with the same material rice starch or rice flour the values of K w were increased byabout 50–80 when the glycerolchangedfrom0.20to0.30gglycerol/grawmaterial.Values ofb 1 relatedtoa w1 ¼0.75andb 2 relatedtoa w2 ¼0.02forallthe film samples are also presented in Table 2. The driving force that causes water transfer in the film is given by the side-to-side moisturedifferencei.e.p s b 1 a w1 b 2 a w2 giveningwater/g dry solid. The comparison between the values of b 1 a w1 and b 2 a w2 showsthatthehigherRHdeterminesthedrivingforcethat causes mass transfer through the film. Inside the diffusion cell where RH ¼ 0.02 the films’ surface moistures ranged from about 0.025 to 0.065 g water/g dry solid while outside the cell where RH ¼ 75 the film’s surface moistures ranged from about 0.38 to 0.89gwater/gdrysolid.ThecomparisonofsamplesSG20andSG30 data shows that the increase of K w was caused partially by the increase of the diffusion coefficient D w that depends on the film structurebutmainlybytheincreaseofthesolubilitycoefficientb 1 that depends on the film hygroscopicity. The same reasoning can be used to explain the K w increase for samples FG20 and FG30. On the other hand for the same glycerol concentration rice flour films gave values of K w two times higher than the rice starch films. The comparisonof the values of D w and b 1 for samples SG20 and FG20 and for samples SG30 and FG30 shows that the much higher values of the diffusion coefficients can explain the increase of K w . The higher values of D w can be explained by the more irregular structure of flour based films as reported by Martin-Polo et al. 1992. K w values were not significantly affected by the plasticizer content in the films plasticized with sorbitol neither for starch based films nor for flour based films. 3.6. Mechanical properties The results for tensile strength T elongation at break 3 and YoungmodulusYforallfilmsamplesarepresentedinTable3.The addition of higher contents of plasticizer increased the films’ elongation capacity and decreased their tensile strength as expected. Film samples plasticized with glycerol showed lower tensile strength than films plasticized with sorbitol with the same plasticizer content for both starch and flour based films. This behaviorcanbeassociatedwiththemolecularstructureofglycerol which possesses a small chain more able to enter into the poly- meric net Cuq et al. 1997. The smaller size of glycerol and its greater amount of related water increase its effectiveness as a plasticizer and contributed more plasticization effect than sorbitol at equivalent mass content. Ryu et al. 2002 observed the same behavior for high amylose corn starch films. Tensile strain values of rice starch films were higher than the values found for rice flour films. This result can be explained by both the existence of irregularities at the microstructure level and thepresenceoflipidsintheflourbecauselipidsareunabletoform a cohesive and continuous matrix according Pe ´roval et al. 2002. 0.0 0.2 0.4 0.6 0.8 1.0 a w 0 20 40 60 80 100 120 140 160 180 200 220 240 260 280 SG20 SG30 FG20 FG30 SS20 SS30 FS20 FS30 β x 10 5 g water / g dry solid . pa Fig. 3. Solubility coefficient values b for rice starch films and rice flour films plasticized with glycerol and with sorbitol. Table 3 Films’ mechanical properties. Samples Tensile strength MPa Elongation at break Young Modulus MPa SG20 10.9 1.2 c 2.8 0.7 a 532.8 115.6 c SG30 1.6 0.2 a 59.8 9.9 b 21.3 5.0 a SS20 22.3 1.9 e 2.8 0.7 a 1052.6 146.0 e SS30 11.2 1.0 c 3.9 1.9 a 456.3 81.0 c FG20 10.3 1.0 c 2.7 0.5 a 560.7 64.3 c FG30 1.3 0.1 a 66.4 8.5 b 22.2 6.0 a FS20 15.0 2.9 d 2.2 0.4 a 816.0 116.7 d FS30 7.2 1.5 b 4.3 0.3 a 248.6 54.7 b Values with the same letter at the same column are not different statistically p 0.05 by the Tukey test. A.B. Dias et al. / Journal of Cereal Science 51 2010 213–219 218

slide 46:

Films of starch and flour with 0.2 g plasticizer/g raw material showed lowvalues of strain at break 3¼ 2.2–2.8 andpresented higher tensile strength values. Tensile strength was more influ- enced by plasticizer content in films plasticized with glycerol than in films plasticized with sorbitol. Higher values of Young modulus Table 3 were found for films with lower plasticizer content which is in agreement with results that have been reported in the literature Lourdin et al.1997 Mali et al. 2005 among others. On the other hand films plasticized with sorbitol were more rigid than the films plasticized with glycerol at the same concentration behavior that has been also reported by other authors Mali et al. 2005 Mu ¨ller et al. 2008 among others. Itisimportanttonotethatallfilmsampleswereconditionedat 58 RH before the mechanical tests. It was observed that the equilibrium moisture of the film FG30 0.20 g water/g dry solids was higher than the moisture of the film FS30 0.12 g water/g dry solid.Aswaterisapowerfulplasticizerinstarchyandproteinrich materials films with glycerol are also plasticized by water due to their higher moisture explaining their lower tensile strength and lower Young modulus and also their higher elongation capacities. 4. Conclusions Rice flour films prepared in the present work have similar mechanical properties to those of starch based films. However theirwatervaporpermeabilitiesaretwotimeshigherthanthoseof starch based films when both are prepared with glycerol. Films with sorbitol are less permeable to water and more rigid while films with glycerol are more plasticized and have poorer water vaporbarrierproperties.Theselectionoftheplasticizerdependson thespecificapplication.Thepresenceoflipidsinthericeflourdoes not cause important changes in film hygroscopicity similar water sorption isotherms. From the results presented in this work it is clear that the permeabilities are controlled mainly by plasticizer concentration. In fact both starch and flour films present poor water vapor barrier and are not indicated for packaging low moisturefoodforexample.Inotherwordsthehigherpermeability of flour films is nota big problem and flour is a good raw material to prepare edible films. On the other hand preparing edible films from rice flour is a new alternative for using this raw material which is sometimes much cheaper than commercial starches. New studies are necessary to better understand how proteins lipids and starch interact in the film polymeric matrix and to find correctprocedurestopreparemorehomogeneousfilms.Theuseof reinforcing fibers is a good alternative to improve film mechanical propertiesandwatersensibilitybutwillbethesubjectofafurther paper. References AOAC – Association of Official Analytical Chemists 1996. Official Methods of Analysis16th ed. AOAC Washington. ASTM 2000. Standard test method for tensile properties of thin plastic sheeting. D882-00.In:AnnualBookofASTMStandards.AmericanSocietyforTesting and Materials Philadelphia. Ave ´rous L. Fringant C. Moro L. 2001. Plasticized starch–cellulose interactions in polysaccharides composites. Polymer 42 6565–6572. Baldwin E.A. Nisperos-Carriedo M.O. Baker R.A. 1995. Use of edible coatings to preserve quality of lightlyand slightly processed products. Critical Reviews in Food Science and Nutrition 35 509–524. Bell L.N. Labuza T.P. 2000. Moisture Sorption – Practical Aspects of Isotherm Measurement and Use second ed. AACC Egan Press Egan USA. Colla E. Sobral P.J.A. Menegalli F.C. 2006. Amaranthus cruentus flour edible films: influence of stearic acid addition plasticizer concentration and emulsion stir- ring speed on water vapor permeability and mechanical properties. Journal of Agricultural and Food Chemistry 54 6645–6653. Coupland J.N. Shaw N.B. Monahan F.J. O ´ Riordan E.D. O ´ Sullivan M. 2000. Modeling the effect of glycerol on the moisture sorption behavior of whey protein edible films. Journal of Food Engineering 43 25–30. CuqB.GontardN.CuqJ.L.GuilbertS.1997.Selectedfunctionalpropertiesoffish myofibrillar protein-based films as affected by hydrophilic plasticizers. Journal of Agricultural and Food Chemistry 45 622–626. Fama ´ L. Gerschenson L. Goyanes S. 2009. Starch-vegetable fibre composites to protect food products. Carbohydrate Polymers 75 230–235. GontardN.GuilbertS.CuqJ.L.1992.Ediblewheatglutenfilms:influenceofmain process variables on films properties using response surface methodology. Journal of Food Science 57190–199. Hagenimana A. Ding X. Fang T. 2006. Evaluation of rice flour modified by extrusion cooking. Journal of Cereal Science 43 38–46. KrochtaJ.M.MillerK.S.1997.Oxygenandaromabarrierpropertiesofediblefilms: a review. Trends in Food Science and Technology 8 228–237. Laohakunjit N. Noomhorm A. 2004. Effect of plasticizers on mechanical and barrier properties of rice starch film. Starch/Sta ¨rke 56 348–356. LarotondaF.D.S. Matsui K.N. Sobral P.J.A. Laurindo J.B. 2005. Hygroscopicityand water vapor permeability of Kraft paper impregnated with starch acetate. Journal of Food Engineering 71 394–402. Leung H.K. 1986. Water activity and other colligative properties of foods. In: Okos M.R. Ed. Physical and Chemical Properties of Food. American Society of Agriculture Engineers Michigan pp.138–185. Lourdin D. Bizot H. Collona P. 1997. Antiplasticization in starch-glycerol films Journal of Applied Polymer Science 631047–1053. Lumdubwong N. Seib P.A. 2000. Rice starch isolation by alkaline protease diges- tion of wet-milled rice flour. Journal of Cereal Science 31 63–74. Mali S. Grossmann M.V.E. Garcı ´a M.A. Martino M.N. Zaritzky N.E. 2002. Microstructural characterization of yam starch films. Carbohydrate Polymers 50 379–386. Mali S. Sakanaka L.S. Yamashita F. Grossmann M.V.E. 2005. Water sorption and mechanical properties of cassava starch films and their relation to plasticizing effect. Carbohydrate Polymers 60 283–289. Mariniello L. Pierro P. Esposito C. Sorrentino A. Masi P. Porta R. 2003. Prepa- rationandmechanicalpropertiesofediblepectin-soyflourfilmsobtainedinthe absence or presence of transglutaminase. Journal of Biotechnology 102 2 191–198. Martelli S.M. Moore G. Paes S.S. Gandolfo C. Laurindo J.B. 2006. Influence of plasticizers on the water sorption isotherms and water vapor permeability of chickenfeatherkeratinfilms.LWT –FoodScience and Technology 39 292–301. Martin-Polo M. Mauguin C. Voilley A. 1992. Hydrophobic films and their effi- ciency against moisture transfer.1. Influence of the film preparation technique. Journal of Agricultural and Food Chemistry 40 407–412. Moore G.R.P. Martelli S.M. Gandolfo C. Sobral P.J.A. Laurindo J.B. 2006. Influ- ence of the glycerol concentration on some physical properties of feather keratin films. Food Hydrocolloids 20 975–982. Moraes J.O. 2009. Propriedades de filmes de amido incorporados de nanoargilas e fibras de cellulose. MSc thesis UFSC Brazil.123 p. Mu ¨llerC.M.O.YamashitaF.LaurindoJ.B.2008.Evaluationof theeffectofglycerol andsorbitolconcentrationandwateractivityonthewaterbarrier properties of cassava starch films through a solubility approach. Carbohydrate Polymers 72 1 82–87. Pe ´rovalC.DebeaufortF.Despre ´D.VoilleyA.2002.Ediblearabinoxylan-basedfilms. 1. Effects of lipid type on water vapor permeability film structure and other physicalcharacteristics.JournalofAgriculturalandFoodChemistry503977–3983. Rayas L.M. Herna ´ndez R.J. 1997. Development and characterization of biode- gradable/edible wheat protein films. Journal of Food Science 62 1160–164. RyuS.Y.RhimJ.W.RohH.J.KimS.S.2002.Preparationandphysicalpropertiesof zein coated high amylose corn starch film. Lebensmittel-Wissenschaft und- Technologie 35 680–686. Saranto ´poulos C.I.G.L. Oliveira L.M. Padula M. Coltro L. Alves R.M.V. Garcia E.E.C. 2002. Embalagens pla ´sticas flexı´veis: Principais polı ´meros e avaliaça ˜o de propriedades. CETEA/ITAL Campinas Brazil. Tapia-Bla ´cido D. Sobral P.J.A. Menegalli F.C. 2005. Development and character- ization of edible films based on amaranth flour Amaranthus caudatus. Journal of Food Engineering 67 215–223. YamamotoK.SumieS.ToshioO.1973.Propertiesofricestarchpreparedbyalkali method with various conditions. Denpun Kagaku 20 99–102. Zhou Z. Robards K. Helliwell S. Blanchard C. 2002. Composition and functional properties of rice. International Journal of Food Science Technology 37 849–868. A.B. Dias et al. / Journal of Cereal Science 51 2010 213–219 219

slide 47:

Development and characterization of a Triticum aestivum-H. villosa T5VS 5DL translocation line with soft grain texture Ruiqi Zhang Yaping Cao Xiue Wang Yigao Feng Peidu Chen National Key Laboratory of Crop Genetics and Germplasm Enhancement Cytogenetics Institute Nanjing Agricultural University Weigang No. 1 Nanjing Jiangsu 210095 China article info Article history: Received 22 September 2009 Received in revised form 2 December 2009 Accepted 9 December 2009 Keywords: Wheat Haynaldia villosa T5VS 5DL translocation line Soft endosperm texture abstract TheHardnesslocusontheshortarmofchromosome5Disthemaindeterminantofgraintextureinbread wheat. The Pina and Pinb genes are tightly linked at this locus and the soft kernel texture phenotype results when both genes are present and encode the wild-type puroindoline proteins PINA and PINB. In this studya compensating T5VS 5DLTriticum aestivum-Haynaldia villosa translocation line NAU415 was characterized by chromosome C-banding genomic in situ hybridization and molecular markers. Single KernelCharacterizationSystemSKCSanalysisandscanningelectronmicroscopyindicatedthatNAU415 had softendosperm although it lacked the wheat Pina-D1a and Pinb-D1a genes suggesting the presence of functional Pin gene orthologs on chromosome 5VS. Using a PCR approach Pina-related designated Dina and Pinb-related Dinb genes in H. villosa and NAU415 were identified and sequenced. The nucleotide and predicted amino acid sequences showed close similarities tothewild-type puroindolines of T. aestivum cv. Chinese Spring. The tryptophan-rich regions of both Dina and Dinb showed a sequence change from lysine-42 to arginine a feature that may have an effect on grain texture. The potential of T5VS 5DL translocation line as a source of genes that may be used for modulation of endosperm texture and other valuable traits in wheat breeding is discussed. 2010 Elsevier Ltd. All rights reserved. 1. Introduction Graintextureorhardnessisoneofthemaincharacteristicsthat determine the processing properties of bread wheat Triticum aestivum L. including tempering conditions milling behavior and performance and end-use quality. Starch damage and size of the flour particles generally increase with grain hardness Greffeuille et al. 2006. Hard wheat flours are usually used for bread-making whereas soft wheat flours are more suitable for biscuits cookies and cakes. Grain hardness is controlled byone major genetic locus that is the Hardness Ha locus on the short arm of chromosome 5D. The locus contains two closely linked genes puroindoline a Pina and puroindoline b Pinb which confer soft endospermwhen both are in their wild state Pina-D1a/Pinb-D1a. Hard texture results from absence of Pin genes as in the case of tetraploid wheats which lack the D genome or from mutations in either Pina or Pinb. Puroindolines encoded by the Pin genes consist of 148 amino acid residues. They are cysteine-rich proteins with 10 cysteine residues forming five disulphide bridges have a unique trypto- phan-rich domain and a molecular weight of approximately 13 kDa Morris 2002. PCR amplification and genomic Southern blotting analysis indicatedthatpuroindoline-likegeneswerepresentinallexamined diploidancestorsofbreadwheatwithgenomessuchasAASSDD MM CC and UU and the tetraploid wheat species Triticum tim- opheevii AAGG but absent in tetraploid durum pasta wheat AABB Chen et al. 2005 Gautier et al. 2000 Li et al. 2008. AlthoughPingenesarepresentinthediploiddonorsoftheAandB genomesorthologous puroindolinegenesonchromosomes5Aand 5B have not been identified in cultivated polyploid wheat indi- cating they were deleted from those chromosomes after poly- ploidization Chantret et al. 2005 Li et al. 2008. In addition puroindoline-like sequences were detected in oats Avena sativa barley Hordeum vulgare and rye Secale cereale in which they were named as avenoindoline hordoindoline and secaloindoline respectively Bhave and Morris 2008. The presence of functional Pin homologs in wheat-related species opens the possibility of extendingtherangeofgraintexturesandallowsspeculationonthe Abbreviations: bp Base pairs CS Wheat cultivar Chinese Spring DNA Deoxy- ribonucleic acid GISH Genomic in situ hybridization Ha Grain hardness gene PCR Polymerase chain reaction PINA Puroindoline a protein Pina Puroindoline a gene PINB Puroindoline b protein Pinb Puroindoline b gene SEM Scanning electron microscopy SNPs Single nucleotide polymorphisms SKCS Single Kernel characterization system. Corresponding author. Tel.: þ86 025 84396026 fax: þ86 025 84395344. E-mail address: pdchennjau.edu.cn P. Chen. Contents lists available at ScienceDirect Journal of Cereal Science journal homepage: www.elsevier.com/locate/jcs 0733-5210/ – see front matter 2010 Elsevier Ltd. All rights reserved. doi:10.1016/j.jcs.2009.12.001 Journal of Cereal Science 51 2010 220–225

slide 48:

molecular evolution of puroindoline and puroindoline-like genes. However little is known about grain texture genes in Haynaldia villosa. H. villosa L. Schur syn. Dasypyrum villosum L. Candargy family Poaceae tribe Triticeae subtribe Triticineae 2n¼ 2x¼ 14 VV an annual diploid grass is recognized as a species potentially usefulforwheatimprovement.Itpossesseshighlevelsofresistance to several important wheat diseases such as the rusts Jan et al. 1986 powdery mildew Chen et al. 1995 and wheat spindle streak mosaic virus WSSMV Zhang et al. 2005. It also contains genes that can increase the amount of seed storage protein lysine content and gluten strength De Pace et al. 2001. The powdery mildew resistance gene Pm21 has been transferred from H. villosa into wheat through the development of hybrids amphiploids and addition Liu et al.1988 substitution Chen et al.1995 Liu et al. 1993 and finally translocation Chen et al. 1995 Liu et al. 1993 lines. In the present study we developed and characterized a T. aes- tivum-H. villosa T5VS 5DL translocation line NAU415 and measured its grain texture by the Single Kernel Characterization System SKCS and scanning electron microscope SEM. The primary goal was to determine whether puroindoline-like genes located on chromosome 5VS contribute to soft grain texture and potentially provide a new germplasm for kernel texture manipulation. 2. Materials and methods 2.1. Plant materials The H. villosa parental line 91C43 originally introduced from Cambridge Botanical Garden UK was used as the donor parent in the production of wheat-H. villosa alien chromosome addition lines. T. aestivum cv. Chinese Spring CS nulli/tetrasomic lines N5AT5D N5BT5D N5DT5B and the ditelosomic 5DL Dt5DL line were kindly provided by the Wheat Genetics Resource Centre Kansas State University Manhattan KS USA. Triticum durum cv. CI 1286introductionnumberoftheChineseAcademyofAgricultural Sciences T. durum cv. 1286-H. villosa amphiploid AABBVV Tri- ticum aestivum cv. CS-H. villosa disomic addition lines 1V-7V DA1V-7V T. aestivum cv. CS-H. villosa disomic substitution line DS5V 5A and T. aestivum cv. Chinese Spring are all maintained at theCytogeneticsInstituteNanjingAgriculturalUniversityCINAU China. 2.2. Cytogenetic methods The procedures for C-banding and chromosome identification were according to Gill et al. 1991 and that for genomic in situ hybridization GISH followed Chen et al. 1995. Fluorescence signals were visualized directly with an Olympus fluorescence microscope BX60 and photographed with an SPOT Cooled Color Digital Camera. 2.3. DNA isolation and PCR amplification Genomic DNAs were isolated from young leaves using the procedure of Devos et al. 1992. STS markers Xcinau43 -245 Xci- nau41 -745 and Xcinau42 -1050 were used to identify the short and long arms of chromosome 5V Cao et al. 2009. SSR markers Xbarc130 5DS Xcfd78 5DS Xcfd81 5DS Xcfd29 5DL and Xgwm272 5DL were used to identify the short and long arms of chromosome 5D Somers et al. 2004 http://wheat.pw.usda. The primers and their sequences are listed in Table 1. PCR amplifications were conducted in a 25 ml reaction mixture containing 1 Taq DNA polymerase buffer 0.8 mmol/L MgCl 2 0.8mmol/LdNTPs100mmol/Lprimers2unitsDNApolymeraseand 50 ng genomic DNA as template. The samples were denatured at 94 Cfor5minandsubjectedto35cyclesof1minofdenaturation at94 C50sannealingatT m and1.2minextensionat72 C.Afinal cyclewithanextensionof10minat72 Cwasappliedtocomplete the reactions. The PCR products were analyzed on 8 poly- acrylamide gels in 1 TBE buffer. 2.4. Hardness measurement by Single Kernel Characterization System SKCS Clean unbroken grains were used to determine kernel texture using a Perten Single Kernel Characterization System SKCS 4100 following the manufacturer’s instructions. SKCS hardness values were obtained from crushing 300 individual kernels from each sample and the data were used to classify the genotypes as soft mixed or hard types. 2.5. Determination of grain texture by scanning electron microscope SEM Maturedryseedswerefrozeninliquidnitrogenandtransferred under vacuum to a SEM preparation chamber. Samples were then fracturedetchedbysublimationat 85 Cfor2minsputtercoated with gold and finally examined at 25 kV in a Hitachi High-Tech- nologies Corporation Model S-3000N scanning electron micro- scope. Images were made at 1500 magnification. 2.6. DNA sequencing The PCR fragments were eluted from 1 agarose gels and cloned into the pGEM-T Easy Vector Promega Madison WI USA. Monoclones containing inserts of the correct size were sequenced using the dideoxynucleotide chain termination method by Shanghai Bioasia Biotechnology Co. Ltd China. Sequence analyses and characterization were performed using DNAMAN software. 3. Results 3.1. Cytological analysis PollenoftheT.durum-H.villosaamphiploidwasirradiatedwith 1200 rad ofg-rays from a 60 Co source and used to pollinate T. aes- tivum cv. Chinese Spring the M 1 plants were backcrossed to Chinese Spring Bie et al. 2007. In subsequent progenies BC 4 F 2 a plant with a single T. aestivum-H. villosa translocation chromo- some was identified by C-banding/GISH and the homozygous translocationline2n¼42accessionedasNAU415wasselectedin the following generation. Sequential C-banding/GISH results Table 1 Primers and their sequences to verify the translocation line in this study. Primer Forward primer 5 0 / 3 0 Reverse primer 5 0 / 3 0 cinau43 GCGCAAATTTCACAGC TGCCACACTAGTGGT cinau41 CTCCAAGAGCCCAGATAG AGGGTGGGGAGAAAGTTA cinau42 CTCCTCGGAAGGTCTCAAGAT TACAACGCTTGGTTGGGTATC barc130 GCTAGTAGTTGGAGTGTTGG ACCGCCTCTAGTTATTGCTCTC cfd78 ATGAAATCCTTGCCCTCAGA TGAGATCATCGCCAATCAGA cfd81 TATCCCCAATCCCCTCTTTC GTCAATTGTGGCTTGTCCCT cfd29 GGTTGTCAGGCAGGATATTTG TATTGATAGATCAGGGCGCA gwm272 TGCTCTTTGGCGAATATATGG GTTCAAAACAAATTAAAAGGCCC R. Zhang et al. / Journal of Cereal Science 51 2010 220–225 221

slide 49:

showed a unique pair of chromosomes with a characteristic dark terminal band one weak band near the centromere on the short arm and only weak bands in the middle on the long arm Fig.1a andb.ComparedwiththestandardC-bandingpatternsofH.villosa Liu et al.1993 and common wheat Gill et al.1991 this pair of chromosomes were composed of 5VS Fig.1b from H. villosa and 5DL from wheat. GISH analysis localized the translocation break- point to the centromeric region suggesting that the translocation arose bycentric breakage of chromosomes 5V and 5D followed by fusionofthe5VSand5DLarms.GISHanalysisofpollenmothercells at meiotic metaphase I of NAU415 revealed that the T5VS 5DL translocation chromosomes paired normally as a ring bivalent and disjuncted normally at anaphase I Fig.1c and d. 3.2. Molecular verification of the T5VS5DL translocation line Twomarkersspecificto5VSXcinau43 -245 Xcinau41 -745 andone marker specific to 5VL Xcinau42 -1050 were used for further char- acterizationofthetranslocationline.ThePCRanalysisshowedthat thespecificbandsfor5VSwerepresentinlineNAU415aswellasH. villosa T. durum-H. villosa amphiploid and T. aestivum-H. villosa DA5V whereas the specific band for 5VL was absent in line NAU415Supplemental Figure S1. This confirmed that the short arm of the translocation chromosome was 5VS. SSR markers Xbarc130 Xcfd78 Xcfd81 Xcfd29 and Xgwm272 locatedontheshortandlongarmsofchromosome5Drespectively wereusedforfurthercharacterizationofthetranslocationline.The results showed that chromosome arm 5DS was not present in the translocation line whereas chromosome arm 5DL was present. Clearly NAU415 is a T5VS 5DL translocation line. 3.3. SKCS hardness measurement As indicated in Table 2 Chinese Spring N5AT5D and N5BT5D displayed soft grain texture whereas N5DT5B and ditelosomic 5DL Dt5DLwerehardtextured.Theabsenceofchromosome5DSthus ledtoanincreaseintheSKCSindexduetolossofthePingenesand their products. T. durum cv. CI 1286 lacking the D genome had a very hard grain texture but the T. durum-H. villosa amphiploid AABBVV was extremely soft indicating that Puroindoline-related genes were present in the V genome. The T5VS 5DL translocation line NAU415 was also soft textured consistent with the 5V 5A substitution and 5V addition lines but all threewerenot as soft as the amphiploid. These results demonstrated the presence of Pin- related genes on chromosome 5VS. Fig. 1. Chromosome sequential C-banding a and GISH b on root tip cells of NAU415 2n ¼ 42 Arrows show the T5VS 5DL translocation chromosome pair. c: Meiotic MI chromosomes of translocation line the ring bivalent formed by a pair of T5VS 5DL is indicated with an arrow d: Normal disjunction of the translocation chromosome pair at anaphase I. Table 2 Grain hardness measurements by SKCS. Line Diameter mm 1000-Grain weight g Hardness SKCS Classification Chinese spring 2.24 37.9 45 Soft N5AT5D 1.82 34.1 40 Soft N5BT5D 1.62 26.9 40 Soft N5DT5B 2.21 36.9 63 Hard Dt5DL 2.18 36.2 70 Hard Sub5V 5A 2.39 38.6 33 Soft DA5V 1.96 34.1 28 Soft T. durum cv. CI 1286 2.43 43.1 83 Hard T. durum-H. villosa amphiploid 1.76 35.3 14 Soft NAU415 T5VS 5DL 1.93 33.6 34 Soft R. Zhang et al. / Journal of Cereal Science 51 2010 220–225 222

slide 50:

3.4. Determination of grain texture by SEM For further characterization of the grain texture of the T5VS 5DL translocation line the degree of direct adhesion between starch granules and matrix proteins of freeze-fractured grain was further examined by scanning electron microscopy SEM Beecher et al. 2002 Chen et al. 2005Fig. 2. There was a clear difference between T. durum cv. CI 1286 hard and the T. durum-H. villosa amphiploid soft. The matrix proteins were cleanly separated from the surface of the starch granules in the amphiploid Fig. 2b whereas they adhered in T. durum cv. CI 1286 Fig. 2a. Analysis of fractured samples of H. villosa and NAU415 Fig. 2c d gave similar results. These results further confirmed the soft textured character of both H. villosa and the translocation line and the presence of functional Pin gene orthologs located on chromosome 5VS. 3.5. Molecular characterization of puroindoline-like genes in H. villosa and NAU415 In order to obtain the functional Pin gene homologs Pina- and Pinb-specific PCR primers wereused to amplifygenomic DNAof H. villosaandNAU415.Fragmentsofca.524bpwereamplifiedinCSH. villosa T. durum-H. villosa amphiploid and NAU415 whereas no amplification was produced in T. durum cv. CI 1286 using the forward 5 0 -CATCTATTCATCTCCACCTGC-3 0 and reverse 5 0 -GTGA- CAGTTTATTAGCTAGTC-3 0 primers which amplified a 524 bp sequence of Pina containing the coding sequence Lillemo et al. 2006Supplemental Figure S2a. Fragments of ca. 447 bp were amplifiedinthesamelinesbutnotinT.durumcv.CI1286usingthe forward 5 0 -ATGAAGACCTTATTCCTCCTAGC-3 0 and reverse 5 0 - TATAGATATCATCACCAGTAATAGCC-3 0 primersthatamplifya447bp sequence of Pinb including the coding sequence Gautier et al. 1994SupplementalFigureS2b.ThePCRproductsamplifiedfrom H. villosa and T5VS 5DL translocation line were sequenced and named as dasyoindoline-a Dina and dasyoindoline-b Dinb respectivelybasedon theearliernameD. villosumof the species. Dinasequences obtained bothfrom H. villosa and NAU415 were identical in length 515 bp and nucleotide sequence Genbank accession number GU211902. The 438 bp nucleotide sequence of the coding region had 92.6 identity with puroindoline-a Pina- D1a from Chinese Spring Genbank DQ363911 and had two insertion–deletion polymorphisms and 24 single nucleotide poly- morphismsSNPs.AmongthemoneSNPwasachangefromGtoA at position 434 resulting in a TAG stop codon adjacent to the ‘normal’ TGA stop codon Fig. 3a. The Dina protein had a deduced 144 amino acids and a conserved feature domain of puroindolines the 10 cysteine backbone and tryptophan-rich domain and showed 89.2 identity with soft pina and an 11 amino acid replacement including a Lys/Arg substitution within the trypto- phan motif at position 42 Fig. 3b. Dinb sequences obtained from H. villosa and NAU415 were also the same in length 455 bp and nucleotide sequence Genbank accessionnumber GU211903. Theircoding sequence 444 bp had 93.3 identity with puroindoline-b Pinb-D1a from Chinese Spring Genbank DQ363913 and with one insertion–deletion poly- morphism and 28 SNPs Fig. 3a. Dinb had a deduced 147 amino acids contained the conserved feature domain of puroindolines and showed 91.9 identity with Chinese Spring and an 11 amino acids replacement including a Lys/Arg substitution within the tryptophan motif at position 42 Fig. 3b. The similarities between theDinand Pingenesfurtherprovedthatchromosome5VScarries orthologs of Pina-D1a and Pinb-D1a. The variations in Din relative to Pin open opportunities for investigations of structure/function relationships. 4. Discussion In recent years there have been several studies on the distri- bution of Puroindoline-related genes in the Gramineae including non-Triticeae tribes. Wheat Pin-related genes occur in rye S. cere- ale oat A. sativa and barley H. vulgare but not in maize Zea maysriceOryzasativaorsorghumSorghumvulgareBhaveand Morris2008.Inthisstudyweobtainedevidenceforthepresence of Pin-related genes in the diploid species H. villosa and located them on chromosome arm 5VS. Variation in the tryptophan-rich domain is of particular importancetothestructureandfunctionofboththePINAandPINB proteins. Nucleotide and predicted amino acid sequence compari- sons showed highly conserved PINA WRWWKWWK and PINB WPTKWWK domains both within and between species Gautier et al. 2000 Massa and Morris 2006. A single amino acid substi- tution in the tryptophan-rich domain of Pinb in common wheat cultivars containing alleles Pinb-D1b Gly-46 to Ser or Pinb-D1d Trp-44 to Arg Morris 2002 resulted in lowamounts of PINB on thesurfacesofstarchgranulesandledtohardgraintextureCorona et al. 2001a b. We identified a nonsynonymous substitution aminoacid-altering mutation Lys-42to -Argin the tryptophan- rich region of Dina WRWWRWWK and Dinb WPTRWWK Fig. 3b. These mutations may be of interest in relation to grain texture.ThehardnessindexofNAU41534wassignificantlylower than Chinese Spring 45 although they had similar genetic back- grounds and were grown in the same environment Table 2. Likewise the hardness indices of Substitution 5V 5A 33 and DA 5V 28 with identical Pina/Pinb and Dina/Dinb genotypes were lower than those of N5AT5D 40 and N5BT5D 40 with extra copiesofthePina/PinbgenesTable2.Itseemsthatthegenotypeof Dina/Dinb has much softer grain texture than Pina-D1a/Pinb-D1a. This may due to the effect of an R Arg instead of a K Lys in the tryptophan-rich domain Fig. 3b. Otherwise the SKCS hardness of Fig.2. Stereo scanned electronmicroscopyof freeze-fractured grainsof T. durum cv. CI 1286 hard a T. durum-H. villosa amphiploid soft b H. villosa c and NAU415 d. The matrix protein M adhered to the surfaces of the starch granules S in hard textured grains a but separated in soft textured lines b–d. Magnification 1500. R. Zhang et al. / Journal of Cereal Science 51 2010 220–225 223

slide 51:

the T5VS 5DL translocation line NAU415 5V 5A substitution and 5V addition lines was not as soft as the amphiploid AABBVV indicating that there may be further softness-related genes in H. villosa at loci other than on 5VS. We will further study the softness-related genes of H. villosa and measure the hardness of T. aestivum cv. CS- H. villosa disomicaddition lines 1V-7VDA1V-7V. The present results provided evidence that the diploid species H. villosacouldbe a potentiallyvaluable source of puroindolinegenes. The presence of functional Pin-related genes so far only ‘soft’ allelesindiploidwheatgenomesmakesitfeasibletotransferthese genes into bread wheat to further vary the range in grain texture. StudiesofsyntheticwheatswithdifferentT.durumandAe.tauschii parents were used Gedye et al. 2004 Lillemo et al. 2006 whereby critical assessments of the relative contributions of both parents to kernel texture could be assessed. As durum wheats are essentially non-Pin carriers most of the variation in Pin should be relatedto Ae. tauschii. Any desirable Pin alleles in synthetic wheats can easily be incorporated into bread wheat but it will be more difficult to transfer and utilize desirable genes from the V genome becauseoflackofchromosomehomology.Inthepresentstudywe transferred Din genes from H. villosa into bread wheat by the production of a compensating T5VS 5DL translocation and this genetic resource could be used in soft wheat breeding. Assumingtheagronomiceffectsof thelossofchromosome5DS is fullycompensated by the 5VS chromosome the selection of soft genotypes could be achieved by the identification of T5VS 5DL using the molecular markers Xcinau43 -245 and Xcinau41 -745 Supplemental Figure S1 instead of physically measuring grain hardness. The identified T5VS 5DL translocation line provides a new genetic resource that is different from the ‘soft’ wild-type phenotype produced by the bread wheat Pina-D1a and Pinb-D1a alleles. Acknowledgements We are grateful to Prof. R.A. McIntosh for his critical review and Prof. C.F. Morris for his valuable suggestions for this manu- script. We are also very grateful to Dr. Z.H. He and Dr. Y. Zhang for their assistances with the hardness measurements. This study was supported by National Natural Science Foundation of China No. 30871519 National High Technology Research and Development Program of China 2006AA100102 Program of Introducing Talents of Discipline to Universities China B08025 and Foun- dation of the National Key Laboratory of Crop Genetics and Germplasm Enhancement Nanjing Agricultural University ZW2008003. Fig.3. Nucleotide sequences a and deduced amino acid sequences b of the Pina and Pinb genes in commonwheat cv. Chinese Spring and Dina and Dinb genesin the T5VS5DL translocation line NAU415. Polymorphic sites are shaded the ‘‘tryptophan motif’’ is indicated by bars and the Lys/Arg substitution within position 42 is shown by arrows. R. Zhang et al. / Journal of Cereal Science 51 2010 220–225 224

slide 52:

Appendix. Supplementary material Supplementarydataassociatedwiththisarticlecanbefoundin the online version at doi: 10.1016/j.jcs.2009.12.001 References Beecher B. Bettge A. Smidansky E. Giroux M.J. 2002. Expression of wild-type pinbsequenceintransgenicwheat complements ahardphenotype.Theoretical and Applied Genetics 105 870–877. BhaveM.MorrisC.F.2008.Moleculargeneticsofpuroindolinesandrelatedgenes: allelicdiversityinwheatandothergrasses.PlantMolecularBiology66205–219. Bie T.D. Cao Y.P. Chen P.D. 2007. Mass production of intergeneric chromosomal translocatons through pollen irradiation of Triticum durum-Haynaldia villosa amphiploid. Journal of Integrative Plant Biology 491619–1626. Cao Y.P. Cao A.Z. Wang X.E. Chen P.D. 2009. Screening and application of EST- based PCR markers specific to individual chromosomes of Haynaldia villosa. Acta Agronomica Sinica 351–10. ChantretN.SalseJ.SabotF.RahmanS.BellecA.LaubinB.DuboisI.DossatC. Sourdille P. Joudrier P. Gautier M.F. Cattolico L. Beckert M. Aubourg S. Weissenbach J. Caboche M. Bernard M. Leroy P. Chalhoub B. 2005. Molecular basis of evolutionary events that shaped the hardness locus in diploidandpolyploidwheatspeciesTriticumandAegilops.PlantCell171033– 1045. Chen M. Wilkinson M. Tosi P. He G.Y. Shewry P. 2005. Novel puroindoline and grain softness protein alleles in Aegilops species with the C D S M and U genomes. Theoretical and Applied Genetics 1111159–1166. ChenP.D.QiL.L.ZhouB.ZhangS.Z.LiuD.J.1995.Developmentandmolecularcyto- genetic analysis of wheat- Haynaldia villosa 6VS/6AL translocation lines specifying resistancetopowderymildew.TheoreticalandAppliedGenetics911125–1128. Corona V. Gazza L. Boggini G. Pogna N.E. 2001a. Variation in friabilin compo- sition as determined by A-PAGE fractionation and PCR amplification and its relationship to grain hardness in bread wheat. Journal of Cereal Science 34 243–250. CoronaV.GazzaL.ZanierR.PognaN.E.2001b.Atryptophan-to-argininechange in the tryptophan-rich domain of puroindoline b in five French bread wheat cultivars. Journal of Genetics and Breeding 55187–189. DePaceC.SnidaroD.CiaffiM.VittoriD.CiofoA.CenciA.TanzarellaO.A. Qualset C.O. Scarascia-Mugnozza G.T. 2001. Introgression of Dasypyrum villosum chromatinintocommonwheatimprovesgrainproteinquality.Euphytica11767–75. Devos K.M. Atkinson M.D. Chinoy C.N. Liu C. Gale M.D. 1992. RFLP-based genetic map of the homoeologous group-3 chromosomes of wheat and rye. Theoretical and Applied Genetics 83 931–939. Gautier M.F. Aleman M.E. Guirao A. Marion D. Jourdier P. 1994. Triticum aes- tivum puroindolines two basic cysteine-rich seed proteins: cDNA sequence analysis and developmental gene expression. Plant Molecular Biology 25 43–57. Gautier M.F. Cosson P. Guirao A. Alary R. Joudrier P. 2000. Puroindoline genes are highlyconserved in diploid ancestor wheats and related species but absent in tetraploid Triticum species. Plant Science 153 81–91. Gedye K.R. Morris C.F. Bettge A.D. 2004. Determination and evaluation of the sequenceandtexturaleffects of thepuroindolineaandpuroindolinebgenesin a population of synthetic hexaploid wheat. Theoretical and Applied Genetics 1091597–1603. Gill B.S. Friebe B. Endo T.R.1991. Standard karyotype and nomenclature system for description of chromosome bands and structural aberrations in wheat Triticum aestivum L.. Genome 34 830–839. Greffeuille V. Abecassis J. Rousset M. Oury F.X. Faye A. 2006. Grain character- ization and milling behaviour of near-isogenic lines differing by hardness. Theoretical and Applied Genetics 1141–12. Jan C.C. Pace D. Guire C.M. P.E. Qualset C.O.1986. Hybrids and amphiploids of Triticum aestivum L. and T. turgidum L. with Dasypyrum villosum L. Candargy. Zeitschrift fur Pflanzenzu ¨chtung 96 97–106. Li W.L. Li H. Gill B.S. 2008. Recurrent deletions of Puroindoline genesat the grain Hardness locus in four independent lineages of polyploid wheat. Plant Physi- ology 146 200–212. Lillemo M. Chen F. Xia X. William M. Pena R.J. Trethowan R. He Z.H. 2006. Puroindoline grain hardness alleles in CIMMYT bread wheat germplasm. Jour- nal of Cereal Science 44 86–92. Liu D.J. Chen P.D. Pei G.Z. Wang Y.N. Qiu B.X. Wang S.L. 1988. Transfer of Haynaldia villosa chromosomes into Triticum aestivum. In: Miller T.E. Koebner R.M.D. Eds. Proc of the 7th Intern Wheat Genet Symp. Cambridge England July 13–19 vol.1 pp. 355–361. Liu D.J. Chen P.D. Raupp J.W. 1993. Determination of homoeologous groups of Haynaldia villosa chromosomes. In: Li Z.S. Xin Z.Y. Eds. Proc 8th Int Wheat Genet Symp. Beijing China vol.1 pp.181–185. Massa A.N. Morris C.F. 2006. Molecular evolution of the Puroindoline-a Pur- oindoline-b and grain softness protein-1 in the tribe Triticea. Journal of Molecular Evolution 63 526–536. Morris C.F. 2002. Puroindolines: the molecular genetic basis of wheat grain hardness. Plant Molecular Biology 48 633–647. Somers D.J. Isaac P. Edwards K. 2004. A high-density microsatellite consensus map for bread wheat Triticum aestivum L.. Theoretical and Applied Genetics 1091105–1114. Zhang Q.P. Li Q. Wang X.E. Wang H. Lang S. Wang Y. Wang S. Chen P.D. Liu D.J. 2005. Development and characterization of a Triticum aestivum–Hay- naldia villosa translocation line T4VS/4DL conferring resistance to wheat spindle streak mosaic virus. Euphytica 145 317–320. R. Zhang et al. / Journal of Cereal Science 51 2010 220–225 225

slide 53:

Starchgranulessizedistributioninsuperiorandinferiorgrainsofwheatisrelated to enzyme activities and their gene expressions during grain filling Chuanhui Zhang a Dong Jiang a Fulai Liu b Jian Cai a Tingbo Dai a Weixing Cao a a Key Laboratory of Crop Physiology and Ecology in Southern China Ministry of Agriculture/Hi-Tech Key Laboratory of Information Agriculture of Jiangsu Province Nanjing Agricultural University PR China b University of Copenhagen Faculty of Life Sciences Department of Agriculture and Ecology Højbakkegaard Alle ´ 13 DK-2630 Taastrup Denmark article info Article history: Received 4 July 2009 Received in revised form 15 December 2009 Accepted 18 December 2009 Keywords: Wheat Triticum aestivum L. Starch granule size Soluble starch systhase Granule-bound starch synthase abstract Mature wheat endosperm contains A- B- C-type starch granules and each class has unique physi- ochemical properties which determine the quality of starch. The dynamics of the starch granule size distribution activities of starch synthases and expression of starch synthase encoding genes were studiedinsuperiorandinferiorgrainsduringgrainfilling.Comparedwithinferiorgrainssuperiorgrains showedhighergrainweightcontentsofstarchamyloseandamylopectin.TheformationofA-B-C-type starchgranulesinitiatedat4820DAFrespectivelyandwaswellconsistentwiththetemporallychange patterns of starch synthase activities and relative gene expression levels. For instance activities of soluble and granule-bound starch synthases designated SSS and GBSS peaked at 20 and 24 DAF. Genes encoding isoforms of starch synthases expressed at different grain filling periods. In addition SS I was generallyexpressedoverthegrainfillingstagethe SS IIand SS IIIwereexpressedovertheearlyandmid grainfillingstageandthe GBSS Iwasexpressedduring themidtolategrainfillingstage.Inadditionthe time-course changes in activities of starch synthases and expression of starch synthase encoding genes explained well the dynamics of the starch granule size distribution. 2009 Elsevier Ltd. All rights reserved. 1. Introduction The temporal and spatial patterns of starch synthesis in wheat kernelsdifferwiththeirpositionsonaspikeJiangetal.2003.The basal flowerets located on the middle spikelets of wheat spikes usually flower earlier take precedence in grain formation and filling and obtain higher grain weight the so-called superior grains.Incontrastdistalfloweretsonmiddlespikeletsorthoseon the distal spikelets inferior grains are smaller Langer and Hanif 1973.Thelowergrainweightsarereportedtoberelatedtothelate developmentoftheendospermlessendospermcellsandlowgrain filling rate in the inferior grains Gao et al. 1992 Ishimaru et al. 2003. Starchaccountsfortwo-thirdstothree-quartersofwheatkernel dryweightHuclandChibbar1996andisdistributedindifferent classes of granules in the endosperm. Grains of mature wheat barley and their wild relatives contain at least two distinct starch granules according totheirsizes thelargeA-typeand thesmall B- typewithaboundarydiameterof10mmGeeraetal.2006.Avery smallC-typestarchgranulehasalsobeenreportedinthesespecies Bechtel and Wilson 2003 Bechtel et al.1990 and debated to be classified as a B-type because of the difficulty in plotting the boundary between them. In wheat endosperm A-type granules constitutethemajorityofthestarchbyweightBechteletal.1990 Peng et al. 1999 Shinde et al. 2003 whereas B-type including C-typegranulescompriseupto99ofgranulesinnumberRaeker et al.1998. Differences in starchgranule composition Penget al. 1999Shindeetal.2003andtheirmolecularstructureJaneetal. 2003 are associated with the baking quality of wheat flour Park et al. 2005. Starchcontentandcompositiondifferbetweenthesuperiorand inferiorcaryopses located at different positions in the wheat spike Jiang et al. 2003. The low starch content and accumulation rate has been partially ascribed to the weak activities of enzymes for starch synthesis during grain filling in the inferior caryopses of wheatandriceJiangetal.2003Yangetal.2004.Inadditionthe spatialexpressionpatternofstarchsynthaseencodinggenesmight be involved in non-uniform starch synthesis in grains at different Abbreviations: DAF days after flowering GBSS granule-bound starch synthase SSS soluble starch synthase SS I starch synthase I SS II starch synthase II SS III starch synthase III RT-PCR reverse transcriptase-polymerase chain reaction. Corresponding author. College of Agriculture Nanjing Agricultural University No.1 Weigang Road Nanjing Jiangsu Province 210095 PR China. Tel./fax: þ86 25 84396575. E-mail address: jiangdnjau.edu.cn D. Jiang. Contents lists available at ScienceDirect Journal of Cereal Science journal homepage: www.elsevier.com/locate/jcs 0733-5210/ – see front matter 2009 Elsevier Ltd. All rights reserved. doi:10.1016/j.jcs.2009.12.002 Journal of Cereal Science 51 2010 226–233

slide 54:

positions in the spike Denyer et al.1995 Hurkman et al. 2003. Howeverthedifferenceinstarchgranulesizedistributionbetween the superior and the inferior grains has not been documented. In addition little is known how the spatial differences in activities of starchsynthasesandrelatedgeneexpressionpatternscontributeto thedifferentialdistributionpatternsofstarchgranulesizebetween the inferior and superior caryopses. The objective of this paper was to compare the differences in changes of starch granule size distribution patterns during grain fillingbetweenthesuperiorandinferiorgraininwheat.Itwasalso aimedtotestthehypothesisthatthedifferentialstarchgranulesize distribution patterns are related to the temporal and spatial patterns of activities of starch synthases and their encoding gene expressions. 2. Materials and methods 2.1. Plant material WheatTriticumaestivumL.cv.Yangmai158plantsweregrown in the experimental station of Jiangsu Academy of Agricultural ScienceNanjingJiangsuProvincePRChinainthegrowingseason of 2004–2005. Uniform heads with the splikelets located in the midpartoftheheadsfloweringonthesamedateweretaggedfrom 4 days after flowering DAF with a four-day interval till harvest grain moisture of 20–22. The most basal grains from the basal 5–8 spikelets on the tagged spikes were detached as superior grains whereas the most distal grains on the same spikelets were detached as inferior grains. The grains wereimmediatelyfrozenin liquid nitrogen for at least 2h and then stored at 80 C until use. 2.2. Starch isolation TheisolationprocedureofstarchwasaccordingtoBechteletal. 1990withminormodifications.Brieflythecaryopseswerecutat the end of the embryo to remove the embryo using a clean razor blade. The endosperm was then carefully squeezed out of the caryopsis. The endospermwas mixed with buffer solution 25mM Tricine 5mM magnesium acetate 50mM potassium acetate pH 7.5 at 4 C and milled in a micro-blender. The slurry was centri- fuged and the pellets were collected and were suspended in ethanol. The suspension was filtered through a nylon screen with a pore size of 53mm and was washed with excess ethanol. The starch sample was then collected by centrifugation and resus- pendedin0.1MaqueousNaClsolutioncontaining10tolueneand stirred for 1h using a magnetic stirrer at a high speed to remove protein.Thisstepwasrepeateduntilthetoluenelayerbecameclear andnoproteinwaspresent.Thestarchwasre-purifiedbywashing three times with water and twice with ethanol and then dried at 30 C for 48h. During the whole procedure each centrifugation was done at 3000g 10min 4 C and the incubations were con- ducted at 20 C. 2.3. Starch composition Amylose and amylopectin contents in wheat grains were determinedwithacoupledspectrophotometerassaydependingon Jiang et al.’s 2003 description with little modification. Fifty milligrams of standard amylose or amlopectin were stirred with 0.5ml of absolute alcohol and 4.5ml of 1M NaOH for 20min at 85 C and then diluted to a volume of 50ml with distilled water. Standard amylose solutions 0.25 0.5 0.7511.25 and 1.5ml were dilutedrespectivelywith20mldistilledwaterandadjustedtopH 3.5with1Macetumandthen0.5mlofI 2 –KIreagentwasaddedto the solution which was diluted with distilled water to a final volume of 50ml. Standard amylopectin solution 0.51.25 2 2.75 3.5 and 4.25ml were diluted respectively and carried out under thesamereactionconditionasabove.Afterblendingfor20minthe mixtures were scanned with a Helios Gamma spectrophotometer ThermoSpectronicCambridgeUKbetween400and960nm.The absorption peaks of standard amylose reacting with I 2 –KI reagent were630and460nmwhereasthoseofamylopectinwere740and 550nm. The standard equation of amylose or amylopectin was achieved through calculating the relationship of the composition versus the absorption values. Hundred milligrams of milled wheat grains were prepared for analysis and 2ml of solution which was 0 10 20 30 40 50 0 5 10 15 20 25 30 Superior Inferior 4 8 12 16 20 24 28 32 0 2 4 6 4 8 12 16 20 24 28 32 0 5 10 15 20 Days after flowering d h c r a t s t h g i e w n i a r g f o n o i t a l u m u c c A n i a r g g m n i t c e p o l y m a d n a e s o l y m a 1 - AB CD Fig.1. Accumulation of grain weight A starch B amylose C and amylopectin D in superior and inferior grains of wheat during grain filling. C. Zhang et al. / Journal of Cereal Science 51 2010 226–233 227

slide 55:

diluted to a volume of 50ml with distilled water after keeping for 20min at 85 C reacted with the I 2 –KI reagent and absorption measured at 460 550 630 and 740nm. The remaining processes were executed in following the standard sample analysis and the composition was calculated on the basis of a standard equation. Total starch content was the sum of amylose and amylopectin. 2.4. Starch granule size distribution Starch granule size distribution was measured by a Saturn DigiSizer 5200 Micromeritics Instrument Corporation USA by a suspension method with the embedded Standard Volume Liquid SampleHandlingSystem.Thestandardrefractiveindicesusedwere 1.31 for water and 1.52 for starch. Volume frequency percent and mean diameter of starch granules were then automatically measured using the embedded laser light scattering technology and summing Mie scattering models. Each measurement was repeated three times. 2.5. Activities of soluble starch synthase SSS and granule-bound starch synthase GBSS Measurement of starch systhase activities was performed according to Jiang et al. 2003. About 0.5mg frozen grains were weighed and homogenised with a pestle in an ice-cold mortar which contained 5ml buffer solution of 50mM Hepes–NaOH pH 7.510mM MgCl 2 2mM EDTA 50mM 2-mercaptoethanol12.5 v/v glycerol and 5 w/v insoluble PVP polyvinylpyrrolidone- 40. Thirty microliters of the homogenate were added into 1.8ml buffersolutionandthencentrifugedat2000gat4 C.Thesediment was suspended in 2ml of buffer solution for GBSS activity assay. Theremaininghomogenatewascentrifugedat16000gat4 Cand e r f e m u l oVqc n e uyp t n e c re Particle diameter µm DAF 24 DAF 20 0 1 2 3 4 DAF 8 DAF 28 0 1 2 3 4 0.5 1 5 10 50 DAF 4 0 1 2 3 4 5 DAF 12 0 1 2 3 4 DAF 16 DAF 32 0.5 1 5 10 50 AB CD EF GH Fig.2. Dynamicchangeinsize distribution ofstarchgranule fromsuperior grainsinYangmai 158duringgrainfilling.Dashed linesaremarkedat10mmasthelimit betweensmall and large granules. C. Zhang et al. / Journal of Cereal Science 51 2010 226–233 228

slide 56:

thesuspensionwasusedforSSSassay.FortheSSSandGBSSactivity assay the reaction solution containing 100ml of 14mM ADPG and 700mlof50mgml 1 amylopectinwasincubatedat30 Cfor5min and the reactionwas initiated byadding 50ml enzyme extract and stoppedafter20minbyheatinginboilingwaterfor2min.TheADP producedbytheSSSorGBSSwasconvertedtoATPbyadding100ml of 40mM PEP 50ml of 50mM MgCl 2 and 1IUpyruvatekinase and then incubating at 30 C for 30min. The resultant ATP was deter- mined byadding 5ml of luciferin–luciferase reagent. 2.6. RNA isolation and RT-PCR analysis Total RNAwas isolated fromfresh wheat grains with the TRIzol Reagent Kits Invitrogen Carlsbad CA USA treated with RNase– free DNase I. Primers with the following sequences were used for RT-PCR analysis of starch synthase genes: SS I Genbank accession No. AJ292521 CCATTCCAGAGCTCATGAGG and ACGTGTAA- CACGGACAGAGAGG SS II Genbank accession No. AJ269504 GGTTGTGGTACCAAGGTATGGandCCGTATGATGTCGTGAAGCCSSIII Genbank accession No. AF258608 GGCGTTGGATGTGTATATGG and GGTGATGATTCCGACAATAGG GBSS I Genbank accession No. AF286320 CCTCTGCCAGTGAAGAACGACA and GCAGTGGAAG- TACCTCACCCTC and the lengths of amplification products were 818 619 507and597bp respectively.Equal amountof2mgof the totalRNAwas M-MLV reverse-transcribed Promega Madison WI USA into cDNA in a reaction mixture containing 75mM KCl 50mMTris–ClpH8.33mMMgCl 2 10mMDTTmMofeachdNTP 2.5mM random hexamers 25 units RNase inhibitor and 25 units M-MLV reversetranscriptasein afinalvolume of25ml at42 C for 60min and finally denatured at 95 C for 5min. Amplifications were performed according to Hurkman et al. 2003 in 100ml reaction volumes using Promega reagent Promega Madison WI e r f e m u l oVqc n e uyp t n e c re Particle diameter µm DAF 8 0 1 2 3 4 5 DAF 12 0 1 2 3 4 5 DAF 16 DAF 20 0 1 2 3 4 DAF 24 DAF 28 0 1 2 3 4 0.5 1 5 10 50 DAF 32 0.5 1 5 10 50 A BC E G F D Fig. 3. Dynamic change in size distribution of starch granule from inferior grains in Yangmai 158 during grain filling. C. Zhang et al. / Journal of Cereal Science 51 2010 226–233 229

slide 57:

USA. A final extension was carried out at 72 C for 7min and the sampleswereincubatedat4 Cuntilanalysis.Amplificationofeach RNA sample without prior reverse transcription confirmed the absenceofcontaminatingDNA.Thefirst-strandcDNAmixturewas used as a template for semi-quantitative PCR analysis after it was normalized by using the primers GTTCCAATCTATGAGGGATACACG andGAACCTCCACTGAGAACATTACCthatamplifya422bpregionof the Actin gene. Aliquots of RT-PCR products were analyzed in 1.5 agarose gels inTBE buffer following standard procedures. 2.7. Statistical analysis All data were subjected to one-way ANOVAusing the SPSS 11.5 for Windows SPSS Inc. Chicago IL. Difference at P0.05 was considered significant. 3. Results 3.1. Accumulation of amylose and amylopectin The starch amylose and amylopectin content in grains paral- leled each other and increased during grain filling Fig 1. The accumulationsofbothamyloseandamylopectinin superiorgrains were much higher than in inferior grains which were consistent with the higher weight of superior grains than the inferior grains. Total starch content showed a similar trend to amylose and amylopectin. This indicated lower starch synthesis in the inferior grains compared to the superior ones. 3.2. Size distribution of starch granules Thesizedistributionofstarchgranulesfromthesuperiorgrains revealed a single peak population at 4 DAF with a mode diameter of about 3mmFig. 2A. This single population of starch was destined to become the large A-type granules. However starch granuleswerenotdetectedintheinferiorgrainsat4DAF.At8DAF starch granule size exhibited a bimodal distribution with amaximumdiameterofabout25mmFig.2Band22mmFig.3B in the superior and inferior grains respectively. The new class of starch population suggested the initial formation of the small B- type granules. At 12 DAF a broader band of starch granules up to about40mminmaximumdiameterwasobservedFigs.2C3B.At 16DAFanewdifferentclassofstarchgranulepopulationdefined as the C-type granules was synthesized in the superior grains Fig.2D.TheC-typestarchgranulesweresynthesizedlaterinthe inferior grains at ca. 20 DAF Fig. 3C. From 24 to 32 DAF starch granules exhibited three distinct populations A B C-type granule Fig. 2E–G 3F–H. Rapidenlargementsofstarchgranuleswereobservedfrom4to 16 DAF in the superior grains or from 8 to 16 DAF in the inferior grains Fig. 4A. From 16 to 20 DAF the average starch granule diameter from both superior and inferior grains reached the maximum values of ca. 15mm. Fig. 4B showed the highest frequenciesofthesmallandthelargestarchgranulesfrom16to32 DAF. In subsequent weeks after 16 DAF there was a decrease in large granules and an increase in small granules in the highest frequency. This suggested that a rapid enlargement of A-type granules and dramatic increase in small granules in mass and number occurred in the early and late stage of grain filling respectively. 3.3. Activities of starch synthases Activities of SSS and GBSS exhibited single peak curves in both superiorandinferiorgrainswithapeakat20DAFforSSSandat24 DAF for GBSS Fig. 5. SSS activity in both superior and inferior grains increased before 20 DAF and decreased thereafter. SSS activitywasalwayshigherinthesuperiorgrainsthanintheinferior grains especially from 16 to 24 DAF. GBSS activity was nearly constant from 4 to 16 DAF in the superior grains and from 8 to 16 DAF in the inferior grains. With superior grains always having higher activities GBSS activities increased sharply from 16 to 24 DAFandthendramaticallydecreasedafter24DAFinbothsuperior and inferior grains. 3.4. Expression patterns of starch synthase genes The starch synthase genes could be divided into three groups based on the temporal expression pattern Fig. 6. The transcript level of SS I increased from a low level at early stage to a peak at 20 DAF in both superior and inferior grains and decreased dramatically inthe superior grains but was maintained ata high level between 24 DAFand 28 DAF in the inferior grains. The SS II and SS IIIgeneexpressions wereveryhighatthe earlieststage of grain filling 4 DAF in the superior grains while 8 DAF in the inferior grains and then rapidly reached peaks between 12 and 16 DAF and gradually decreased thereafter. At 28 DAF and 32 DAF in the superior grains and 32 DAF in the inferior grains no SS II and SS III expressions were detected. GBSS I did not express during the early grain filling stage i.e. 4 DAF to 12 DAF in the superior grains and 8 DAF to 12 DAF in the inferior grains whilst it was dramatically expressed and reached peaks at 24 DAFand then remained abundantlyexpressed until 32 DAF. Thus SS I was generally expressed over the grain filling stage while SS II and SS III were expressed over the early and mid grain filling stage and the GBSS was expressed during the mid to late grain filling stage. B 4 8 12 16 20 24 28 32 0 1 2 3 4 5 SFSG LFSG SFIG LFIG A 0 3 6 9 12 15 18 Superior Inferior r e t e m a i d n a e M m µ Days after flowering d t n e c r e p y c n e u q e r f e m u l o V Fig. 4. Plot A: dynamic changes in mean diameterof wheat starch granule in superior andinferiorgrainsduringfilling.PlotB:the highestvolumefrequencypercentoflarge and small starch granules in late stage of grain development. SFSG: small fraction in superior grains LFSG: large fraction in superior grains SFIG: small fraction in inferior grainsandLFIG:largefractionininferiorgrains.Thelimitbetweenthetwofractionsis definedastheminimumofcurve.Smallgranulesaresmallerthanthelimitwhilelarge granules are larger than the limit. C. Zhang et al. / Journal of Cereal Science 51 2010 226–233 230

slide 58:

4. Discussion Therearetwoor three classesof starchgranules based on their size and timing of formation in wheat endosperm Bechtel and Wilson2003Bechteletal.1990Geeraetal.2006Parker1985. The formation of the A-type starch granules initiates from very early days of endosperm formation while the B-type starch gran- ulesareinitiatedfromapproximately10DAFParker1985andthe C-typestarchgranulessynthesisisstartedatabout21DAFBechtel and Wilson 2003 Bechtel et al. 1990. Therefore there is a temporal transformation in the size distribution of starch gran- ules during wheat endosperm development. In the present study the distributions of starch granules during wheat endosperm development in the superior and the inferior grains were deter- minedusingalaserlightdiffractionsizeanalyzerwitharesolution capabilityof0.1mm.Threeclassesofstarchgranuleswererevealed in the mature endosperm. Basically the initial formation timing of eachclassgranulewasin agreementwiththatreportedbyBechtel et al. 1990. In the superior grains the A-type starch granules initially formed at 4 DAF while the B-type granule formation was initiated in both superior and inferior grains at 8 DAF and at approximately 20 DAF the tiny C-type starch granules appeared and starch granules exhibited trimodal distributions in both superior and inferior grains. The mean diameter of starch granules increased dramatically before 16 DAF and did not apparently increase after 16 DAF Fig.4A.Thisgeneralprofilecouldbeduetotheenlargementofthe largegranulesA-typeandtheformationofthesmallonesB-and C-type.Abroadbandofgranuleswhichwasabove20mmat8DAF anduptoabout40mmat16DAFindicatedobviousincreasesinthe enlargementofA-typestarchgranulessize.Ontheotherhandthe maximum diameter of starch granules increased slightly after 16 DAF even becoming close to the terminative diameter at 20 DAF andnotvaryingafterthis.Thedynamicchangesinsizedistribution ofstarchgranulesisapparentlyduetoanincreasesintheinitiation of the small-sized starch granules e.g. the B- and C-types espe- cially after 20 DAF Fig. 4B. Recent study indicates that the small granules are formed in vesicles budded off from outgrowths of A- type granule-containing amyloplasts Bechtel and Wilson 2003 Langeveldetal.2000.Accordinglytherewouldbearapidincrease inA-typegranulesizeintheearlystageofgrainfillingandagradual increaseinthesmallgranulemassaftertheenlargementofA-type granules.Ourresultswereingoodagreementwiththisproposition although the physiological evidence for the initiation of small starch granules has not yet been revealed. Grainsareverystrongsinksforcarbohydrateduringgrainfilling inwheatRiffkinetal.1995.Sinkactivityincludingtheactivityof keyenzymes involved in carbohydratemetabolism is a physiolog- icalrestraintinaccumulationofcarbohydratereservesduringgrain filling Kubo et al. 1999 Wang et al. 1993. Starch synthases are involved in starch synthesis from the glucosyl donor ADPGlc Tet- low et al. 2004 their activities are positively correlated to starch accumulationrateJiangetal.2003Yangetal.2004.Inourstudy SSS activity markedly increased in the early stage of grain filling andthendecreasedin thelatestagewhileGBSSactivity increased slightly in the early stage of grain filling before 16 DAF and increased sharply thereafter with a peak value at 24 DAF. These resultswereingoodagreementwiththechangesofstarchgranule size distribution during grain development. SSS was confirmed to havearoleindeterminingthegranulesizeinbarley.ThelowerSSS activity brought on a concomitant reduction in the size of A-type starchgranulesconsequentlyleadingtoaunimodalstarchgranule size distribution rather than a typical trimodal granule size distri- butioninbarleyTyynela ¨ etal.1995.ThelowerornoGBSSactivity s e i t i v i t c a S SSt i n U Days after flowering d s e i t i v i t c a S S BGt i n U A 4 8 12 16 20 24 28 32 0 100 200 300 Superior Inferior B 4 8 12 16 20 24 28 32 0 100 200 300 400 Fig. 5. Dynamic change in SSS left and GBSS right activities in wheat endosperm during grain filling. Unit: nmolADPg 1 FWmin 1 FW: fresh weight. Fig. 6. Expression pattern of the wheat starch synthase genes in superior A and inferior B grain by RT-PCR analysis. The developmental stage of endosperm in days after flowering is given above the lanes. C. Zhang et al. / Journal of Cereal Science 51 2010 226–233 231

slide 59:

partial waxy and waxy resulted in decrease in A-type granules while increase in B-type granules Bertolini et al. 2003 and the rangeofvariationinthegranulesizewaspositivelycorrelatedwith thewaxygradeGeeraetal.2006.Thereforethereshouldbeclose relationsbetweenthechangesinstarchsynthaseactivitiesandthe starch granules size distribution during grain filling. Our results showed that the ratio of large to small starch granules in volume frequencypercentageatleastpartiallywasrelatedtotheinterplay between the SSS and GBSS activities. SSS could be a predominant enzymeresponsibleforstarchgranulesizedistributionintheearly stageofgrainfillingwhileGBSScouldplayanimportantroleinthe ratio of large to small starch granules in volume frequency percentage especially in the late stage of grain filling. InadditionfourisoformsofstarchsynthaseSSISSIISSIIIand GBSS I have been shown to be expressed in the wheat endosperm duringgrainfillingDenyeretal.1995.SSIisprimarilyresponsible for the synthesis of the shortest chains and further extension of longer chains is achieved by SS II and SS III in amylopectin Craig et al. 1998 Gao et al. 1998 Umemoto et al. 2002. GBSS I is not only responsible for the synthesis of amylose but also plays roles for biosynthesis of extra-long unit chains of amylopectin Hana- shiroetal.2008.Howevereachisoformcontributesdifferentlyto the activityof starch synthase. For instance SS II and SS III account formorethan60and80ofthesolublestarchsynthaseactivityin pea embryo and potato tuber respectively Craig et al. 1998. On the other hand SS I is the major contributor to the total soluble starch synthase activity in wheat endosperm and accounts for almost two-thirds of activity Peng et al. 2001. In the present studyexpressionsofgenesencodingSSISSIIandSSIIIandGBSSI were temporally regulated and the expression patterns were consistent with the changes in starch synthases activities. Possible explanations for this phenomenon are either that the expression levels of genes encoding starch synthases determine the activities of these isoforms or that the isoform activities of starchsynthases interacts during the grain filling period. Thus the effects of expressions of starch synthase encoding genes on starch granule formation were related to their regulatory effects on the starch synthase acitivities. The starch granule size distribution patterns were very close between the superiorand inferior grains except for the maximum and average granule sizes. It is notable that the changes in the starch synthase activities and the expressions of the encoding genes showed similar patterns between superior and inferior grainsduringgrainfillingexceptthattherewasnostarchsynthase activity and no expression of the genes at 4 DAF in the inferior grainsandthattheactivitiesofthestarchsynthaseswerelowerin the inferior grains than the superior grains over grain filling. In addition we labeled the flowering heads in the sampling processinordertocollectuniformgrainsforanalysis.Howeverthe timingoffloweringfloweretswasnotloggedandthedevelopment stageofinferiorgrainswasnotparalleltosuperiorgrains.Thuswe only used days after flowering DAF to indicate grain age which wasnottherealageof theinferiorgrainsandsome of theinferior grains were younger than the superior grains. In addition the life duration of inferior grains was shorter than the superior grains since they matured and were harvested at the same time. This couldbeanothercontributortothevariationinstarchgranulesize distribution between these two grains. Further studies are needed to compare the difference in starch granule size distribution between superior and inferior grains with the same age. Collectivelybasedonourpresentresultsitwasconcludedthat the starch granule size distribution in the grains of wheat was associated with the activities of the starch synthases which were regulated at the transcription levels of the genes encoding the starch synthases. Acknowledgements This study was funded by projects of the National Natural Science Foundation ofChina30671216 30700483 30971734 the Natural Science Foundation of Jiangsu Province BK2008329 the Specialized Research Fund for the Doctoral Program of Higher Education20050307006theNCET06-0493andtheearmarked fund for Modern Agro-industry Technology Research System nycytx-03. References Bechtel D.B. Wilson J.D. 2003. Amyloplast formation and starch granule devel- opment in hard red winter wheat. Cereal Chemistry 80175–183. Bechtel D.B. Zayas I. Kaleikau L. Pomeranz Y. 1990. Size-distribution of wheat starch granules during endosperm development. Cereal Chemistry 67 59–63. BertoliniA.C.SouzaE.NelsonJ.E.HuberK.C.2003.Compositionandreactivityof A- and B-type starch granules of normal partial waxy and waxy wheat. Cereal Chemistry 80 544–549. Craig J. Lloyd J.R. Tomlinson K. Barber L. Edwards A. Wang T.L. Martin C. Hedley C.L. Smith A.M.1998. Mutations in the gene encoding starch synthase II profoundly alter amylopectin structure in pea embryos. Plant Cell 10 413–426. Denyer K. Hylton C.M. Jenner C.F. Smith A.M. 1995. Identification of multiple isoforms of soluble and granule-bound starch synthase in developing wheat endosperm. Planta 196 256–265. Gao M. Wanat J. Stinard P.S. James M.G. Myers A.M. 1998. Characterization of dull1 a maize gene coding for a novel starch synthase. Plant Cell 10 399–412. Gao X. Francis D. Ormrod J.C. Bennett M.D. 1992. Changes in cell number and cell division activity during endosperm development in Allohexaploid wheat Triticum aestivum L. Journal of Experimental Botany 431603–1609. Geera B.P. Nelson J.E. Souza E. Huber K.C. 2006. Composition and properties of A- and B-type starch granules of wild-type partial waxy and waxy soft wheat. Cereal Chemistry 83 551–557. Hanashiro I. Itoh K. Kuratomi Y. Yamazaki M. Igarashi T. Matsugasako J.-I. Takeda Y. 2008. Granule-bound starch synthase I is responsible for biosyn- thesis of extra-long unit chains of amylopectin in rice. Plant Cell Physiology 49 925–933. Hucl P. Chibbar R.N.1996. Variation for starch concentration in spring wheat and its repeatability relative to protein concentration. Cereal Chemistry 73 756–758. Hurkman W.J. McCue K.F. Altenbach S.B. Korn A. Tanaka C.K. Kothari K.M. Johnson E.L. Bechtel D.B. Wilson J.D. Anderson O.D. DuPont F.M. 2003. Effect of temperature on expression of genes encoding enzymes for starch biosynthesis in developing wheat endosperm. Plant Science 164 873–881. Ishimaru T. Matsuda T. Ohsugi R. Yamagishi T. 2003. Morphological develop- ment of rice caryopses located at the different positions in a panicle from early to middle stage of grain filling. Functional Plant Biology 301139–1149. JaneJ.YooS.WongK.DuvickS.A.GardnerC.A.2003.Structuresofamylopectin and starch granules – how are they synthesized Journal of Applied Glyco- science 50167–172. Jiang D. Cao W. Dai T. Jing Q. 2003. Activities of key enzymes for starch synthesis in relation to growth of superior and inferior grains onwinter wheat Triticum aestivum L. spike. Plant Growth Regulation 41 247–257. KuboA.FujitaN.HaradaK.MatsudaT.SatohH.NakamuraY.1999.Thestarch- debranching enzymes isoamylase and pullulanase are both involved in amylopectin biosynthesis in rice endosperm. Plant Physiology 121 399–410. Langer R.H.M. Hanif M. 1973. A study of floret development in wheat Triticum aestivum L.. Annals of Botany 37 743–751. Langeveld S.M.J. van Wijk R. Stuurman N. Kijne J.W. de Pater S. 2000. B-type granule containing protrusions and interconnections between amyloplasts in developing wheat endosperm revealed by transmission electron microscopy and GFP expression. Journal of Experimental Botany 511357–1361. ParkS.-H.ChungO.K.SeibP.A.2005.Effectsofvaryingweightratiosoflargeand small wheat starch granules on experimental straight-dough bread. Cereal Chemistry 82166–172. Parker M.L. 1985. The relationship between A-type and B-type starch granules in the developing endosperm of wheat. Journal of Cereal Science 3 271–278. Peng M. Gao M. Abdel-Aal E.-S.M. Hucl P. Chibbar R.N. 1999. Separation and characterization of A- and B-type starch granules in wheat endosperm. Cereal Chemistry 76 375–379. Peng M. Hucl P. Chibbar R.N. 2001. Isolation characterization and expression analysis of starch synthase I from wheat Triticum aestivum L.. Plant Science 1611055–1062. Raeker M.O. Gaines C.S. Finney P.L. Donelson T.1998. Granule size distribution and chemical composition of starches from 12 soft wheat cultivars. Cereal Chemistry 75 721–728. RiffkinH.L. DuffusC.M.BridgesI.C.1995.Sucrosemetabolismduringendosperm development in wheat Triticum aestivum. Physiologia Plantarum 93123–131. C. Zhang et al. / Journal of Cereal Science 51 2010 226–233 232

slide 60:

Shinde S.V. Nelson J.E. Huber K.C. 2003. Soft wheat starch pasting behavior in relation to A- and B-type granule content and composition. Cereal Chemistry 80 91–98. Tetlow I.J. Morell M.K. Emes M.J. 2004. Recent developments in understanding the regulation of starch metabolism in higher plants. Journal of Experimental Botany 55 2131–2145. Tyynela ¨ J. Stitt M. Lo ¨nneborg A. Smeekens S. Schulman A.H.1995. Metabolism of starch synthesis in developing grains of the shx shrunken mutant of barley Hordeum vulgare. Physiologia Plantarum 93 77–84. Umemoto T. Yano M. Satoh H. Shomura A. Nakamura Y. 2002. Mapping of a gene responsible for the difference in amylopectin structure between japonica -type and indica -type rice varieties. Theoretical and Applied Genetics 104 1–8. Wang F. Sanz A. Brenner M.L. Smith A. 1993. Sucrose synthase starch accu- mulation and tomato fruit sink strength. Plant Physiology 101 321–327. Yang J. Zhang J. Wang Z. Xu G. Zhu Q. 2004. Activities of key enzymes in sucrose-to-starch conversion in wheat grains subjected to water deficit during grain filling. Plant Physiology 1351621–1629. C. Zhang et al. / Journal of Cereal Science 51 2010 226–233 233

slide 61:

Journal of Cereal Science – Reviewers in 2009 The Editors would like to express their sincere thanks and appreciation to all those who reviewed manuscripts for the journal during 2009. Joel Abecassis Samson Agboola Jasim Ahmed Sajid Alavi Susan Altenbach Karin Ammar Robert S Anderssen Allan Andersson Anthony Anyia Elke Arendt Paulo Arruda Ioannis Arvanitoyannis Joseph Awika Mohammad Hossein Azizi Antony Bacic Byung-Kee Baik Jinsong Bao Ana Paulina Barba Ian L Batey Scott Roger Bean Donald B Bechtel Zoltan Bedo Frank Bekes Guillermo Bellido Luis Arturo Bello-Perez Peter S Belton James Bemiller Nicola Berardo E Berghofer William Berzonsky Prem Bhalla Kshirod Bhattacharya Mrinal Bhave Anthony Bird Antonio Blanco Ann Blechl Volker Boehm Celine Bottier Chris Boulton Amanda Box Phil Bregitzer B B Buchanan Allen Budde Alain Buleon Peter Butterworth Yusuf Byaruhanga Ismail Cakmak Osvaldo Campanella Grant Campbell Jose Carrillo Stanley P Cauvain Shiaoman Chao Ming-Hsuan Chen Ravindra Chibbar Yong Gu Cho Francisco Cinco-Moroyoqui John Clarke Bryan Clarke Helen Collins Les Copeland Françoise Corbineau Harold Corke Jose Costa Christophe Courtin Riette De Kock Pasquale De Vita Jan Delcour Guy Della Valle Stephen R Delwiche Kay Denyer Jim E Dexter Bogdan J Dobraszczyk Renato D’Ovidio Floyd Dowell Laurence Dubreil Michael Dunn K G Duodu Linda Dykes Viviana Echenique Nancy Edwards Simon Edwards A H El Tinay Peter Ellis Naushad Emmambux Kent Eskridge Evan Evans Lewis Ezeogu J. Faubion Ten Feizi Vincenzo Fogliano Salvatore Foti Peter J Frazier M. F. Gautier Pierre Gelinas Michael Gidley Thomas Gillgren Mike Giroux Robin Graham Robert A Graybosch Ann Hagerman Bruce Hamaker Sarah Harmer Chris Hawes Youna Hemery Robert J Henry Robert D Hill Maria Hrmova Kerry Huber Journal of Cereal Science 51 2010 I–II doi:10.1016/S0733-52101000039-1

slide 62:

Tatsuya M Ikeda Sibel Irmak Colin Jenner Yueming Jiang Eva Johansson Catherine Joly Berne Jones Bienvenido O Juliano Donald Kasarda Joseph Kepiro William Kerr Joan King Daryl Klindworth Peter Koehler Padmanaban Krishnan Paul A Kroon Toshihiro Kumamaru Maryke Labuschagne Bert Lagrain Oscar Larroque John Lawton Alain Le Bail Yinian Li Eunice Li-Chan M Lindhauer Finn Lok Katja Loos Christelle Lopez Tiphaine Lucas Adam Lukaszewski Valérie Lullien-Pellerin Elisabetta Lupotto Guansheng Sheng Ma Ron Madl Marena Manley Daryl Mares Didier Marion John Martin Stefania Masci Anna Maria Mastrangelo Barry McCleary Glenn McDonald Cassandra M McDonough M Meinders Florencia Menegalli Amanda Minnaar J R Mitchell Robert A Moreau Marie-Helene Morel Craig F Morris Francisco Munoz Alan Myers Martijn Noort Lindsay O’Brien Maureen Olewnik Brian Osborne Lizette Oudhuis Serpil Ozturk Natalia Palacios Octavio Paredes-Lopez Mary L Parker Roberto Pena Donatella Peressini Laura Piazza Pietro Piffanelli V Planchot Håkan Pleijel Norberto E Pogna Yves Popineau Charlotte Horsmans Poulsen Kaisa Poutanen Marion Priebe Sadequr Rahman Isela Rojas Lloyd W Rooney Cristina M Rosell Stuart Roy Serpil Sahin Joaquin Salas Andras Salgo Peter Sanders Martin G Scanlon Vicki Schlegel Tilman Schober Koushik Seetharaman Sergio O Serna Saldivar Francesco Sestili Peter Shewry Eyal Shimoni Cavella Silvana Harmit Singh Jaspreet Singh M Sissons Muthulisi Siwela Vicky Solah Wen-Yuan Song J H J Spiertz Baninder Sroan Mats Stading Paul Staswick Prisana Suwannaporn J Stuart Swanston S J Symons Laszlo Tamas Bo Tang Janet Taylor John R N Taylor Valeria Terzi Richard F Tester Ian Tetlow Wade Thomason Lan Tighzert Michael Tilley Evangelos Topakas Patricia Torres Paola Tosi Hans Tromp Luisa Ugolini Takayuki Umemoto Praveen Upreti George van Aken Atze Jan van der Goot Lieke Van Riemsdijk Ton van Vliet Analia Vazquez Frederic Violleau Jianmin Wan Mingwei Wang Donghai Wang Brian Waters Robert Welch Yong Weon Seo Jeff Wilson Colin Wrigley Xiarong Wu Jinrui Zhang Weibiao Zhou II Journal of Cereal Science 51 2010

slide 63:

Calendar Event/Date/Venue Details from 18–22 April 2010 5th EPSO Conference - Plants for Life Lapland Finland 25–27 April 2010 IMR Hydrocolloid Conference Berlin Germany 5–7 May 2010 Open HEALTHGRAIN Conference 2010 Lund Sweden 18–19 May 2010 1st Kiel Food Science Symposium Kiel Germany 18–20 May 2010 Vitafoods 2010 and Finished Products Expo Geneva Switzerland 19–21 May 2010 First International Vitamin Conference Copenhagen Denmark 27–28 May 2010 4th European Workshop on Food Engineering and Technology Belgrade Serbia 30 May – 1 June 2010 2010 CIFST/AAFC Conference: Safe and Healthy Food - Harvesting the Science Winnipeg Canada 8 June 2010 IGC Grains Conference 2010 London UK 8–11 June 2010 2nd International Symposium on Gluten-Free Cereal Products Beverages Tampere Finland 20–24 June 2010 10th International Hydrocolloids Conference Shanghai China Internet: www.epsoweb.org/event/conference/fi nland-2010 Internet: www.hydrocolloid.com Internet: http://lund2010.healthgrain.org E-mail: KielFoodScimri.bund.de Internet: www.mri.bund.de Internet: www.vitafoods.eu.com Internet: www.welcomehome.dk/default.aspxID1784 E-mail: vnedovicagrif.bg.ac.rs Internet: www.cifst.ca Internet: www.igc.org.uk/en/conference/confhome.aspx Internet: www.helsinki.fi /gf10/ Internet: www.10ihc.org Journal of Cereal Science 51 2010 III–IV doi:10.1016/S0733-52101000040-8

slide 64:

30 June–2 July 2010 Food Factory 2010 Gothenburg Sweden 12–14 July 2010 34th National Nutrient Databank Conference Grand Forks North Dakota USA 17–21 July 2010 IFT Annual Meeting and Food Expo Chicago USA 1–4 August 2010 IAFP Annual Meeting Anaheim CA 1–6 August 2010 25th International Carbohydrate Conference Tokyo Japan 11–13 August 2010 International Conference on Nutrition and Food Sciences Stockholm Sweden 18–19 August 2010 5th Innovative Foods Conference - Higher Valued Foods FIESTA 2010 Melbourne Australia 22–26 August 2010 IUFoST 2010 - 15th World Congress of Food Science and Technology Cape Town South Africa 24–27 October 2010 AACC International Annual Meeting Savannah USA Internet: http://meeting.aaccnet.org 25–29 October 2010 International Conference on Food Innovation foodInnova 2010 Valencia Spain 9–12 November 2010 2010 EFFoST Annual Meeting - Food and Health Dublin Internet: www.food-factory.se Internet: http://www.nutrientdataconf.org/ Internet: www.ift.org Internet: www.foodprotection.org Internet: www.bilingualgroup.co.jp/ics2010 Internet: www.waset.org/conferences/2010/ stockholm/icnfs/index.php Internet: www.innovativefoods2010.com/innovativefoods/ Internet: http://www.iufost2010.org.za Internet: http://meeting.aaccnet.org Internet: www.foodinnova.com Internet: www.effostconference.com IV Journal of Cereal Science 51 2010

authorStream Live Help