logging in or signing up KH-Central European Journal of Medicine [Kurtarılan] kadriye Download Post to : URL : Related Presentations : Share Add to Flag Embed Email Send to Blogs and Networks Add to Channel Uploaded from authorPOINT lite Insert YouTube videos in PowerPont slides with aS Desktop Copy embed code: (To copy code, click on the text box) Embed: URL: Thumbnail: WordPress Embed Customize Embed The presentation is successfully added In Your Favorites. Views: 40 Category: Science & Tech.. License: All Rights Reserved Like it (0) Dislike it (0) Added: January 05, 2012 This Presentation is Public Favorites: 0 Presentation Description No description available. Comments Posting comment... Premium member Presentation Transcript Central European Journal of Medicine Phylogenetic analysis of house dust mites: Central European Journal of Medicine Phylogenetic analysis of house dust mites Yubao Cui1,2,3*, Cuixiang Gao1, Ying Zhou1, Peng Zhou2, Ming Peng2, Yingzi Lin3, Jianglong Peng3 Received 18 June 2009; Accepted 4 August 2009Makalenin Önemi : Makalenin Önemi Ev tozu akarları ev tozlarında bulunup vücut parçaları ve özellikle dışkılarında bulunan allerjenler sebebiyle insanlarda astım alerjik rinit atopik dermatid kronik ürtikerMakalede Amaç : Makalede Amaç Ev tozlarında en yoğun olarak bulunan (%90) Dermatophagoides farinae , Dermatophagoides pteronyssinus Euroglyphus maynei üç tür arasında filogenetik ilişkiyi keşfetmek Giriş: Giriş Mite lar yaklaşık yarım mm boyunda krem beyaz renginde Arachnida sınıfındaki arthropodlardır. Dünyada 30 farklı cinsi bulunmuş ve kaydedilmiştir. 30Giriş: Giriş Ev tozu akarları alerjenlerinin en önemlileri grup1 ve grup2 alerjenlerin olduğu kaydedilmiştir. Bu alerjenler sistein proteazı ve HE1 homolojisine sahip allerjenler familyasına mensupturlar.Giriş: Giriş Ev tozu akarlarıyla ilgili filogenetik çalışmalar bulunmasına karşın her iki allerjenin sekanslarının birlikte bulunduğu çalışma yoktur ve bu üç akarın ortak olarak yer aldığı çalışmalar da çok azdır.Grup1 ve Grup2 allerjenlerinin sekansları kullanılarak aralarındaki filogenetik ilişki yorumlanmıştır.: Grup1 ve Grup2 allerjenlerinin sekansları kullanılarak aralarındaki filogenetik ilişki yorumlanmıştır. Dermatophagoides pteronyssinus Dermatophagoides farinae Euroglyphus mayneiMaterial and Method: Material and Method D. farinae kültürü ve izolasyonu Total RNA izolasyonu Der f1 in DNA sekansı ve klonlanması Der f2 in DNA sekansı ve klonlanması Filogenetik ağaç yapımıD. farinae culture and isolation of adult mites: D. farinae culture and isolation of adult mites EV TOZU % 75 bağıl nem 25oC sıcaklık Maya Buğday unu pirinç KÜLTÜR ORTAMI D. farinae 600 MİTE RNA İSOLATİON akarlar larvalar arthrefatlar Çin Halk Cumhuriyeti HaikouTotal RNA isolation: Total RNA isolation Yaklaşık 600 ergin canlı akar likit nitrojen ile hızla donduruldu ve 1ml RNA izolatör eklendi. RNAiso içindeki akarlar Bir Powergen 125 Doku Homojenizatörü ile homojenize edildi.Total RNA isolation: Total RNA isolation Oda sıcaklığında 30 ila 60 saniyelik bir süre içinde 5000 RPM başlayarak yaklaşık 20.000 RPM e kadar kademeli bir artış ile homojenize oldu.Total RNA isolation: Total RNA isolation Homojenizasyondan sonra , tüm mataryaller Doku Homojenizatöründen bir eppendorf tüpe transfer edildi ve 0.2ml kloroform eklendi. üreticinin protokolüne göre Yetişkin D. farinae lerden RNA ekstrakte edildi.Cloning and DNA sequencing of Der f 1: Cloning and DNA sequencing of Der f 1 N ested -PCR la Der f 1 geni amplifikasyonu için GenBank AB034946 içinden F(5’ bamHI GGATCC ATGAAATTCGTTTTGGCCATTG3’), R0(5’TCGCAAGAGTAGTTGTTTTTAT3’), R(5’ CTCGAG TCACATGATTACAACATATGGATATT3’ Xhol )Cloning and DNA sequencing of Der f 1: Cloning and DNA sequencing of Der f 1 Öncelikle revers transkiripsiyon polimeraz zincir reaksiyonu (RT-PCR) amplifikasyonuna kalıp olarak total RNA , One Step RNA PCR Kit i ( TaKaRa ) ile performe edildi.Cloning and DNA sequencing of Der f 1: Cloning and DNA sequencing of Der f 1 Reaksiyon başına 50 μ l lik son hacimin bleşenlerinin dağılımları 20 pmol F ve R0 primer lerinin herbiri ( 1 er μl ) total RNA ( 4 μl ), 2×One Step RNA PCR Buffer ( 25 μl ) 2.5mM dNTP Mixture ( 2 μl ) 40 u/μl RNase Inhibitor ( 1 μ l ) 5 U/μl M-MLV Reverse Transcriptase XL ( 0.5 μ l ) 5 U/ul Ex Taq ( 1 μl ) DEPC H2O ( 14.5 μ l )Cloning and DNA sequencing of Der f 1: Cloning and DNA sequencing of Der f 1 RT-PCR, PCR Thermal Cycler Dice ( TaKaRa ) da 30 dk 50oC RT performe edildi ve 2 dk 94oC başlangıç inkibasyonunu 30 döngü 15 s 98oC, 30 s 57oC ve 1 dk 72oC uzama inkübasyonu 5 dk 72oC final inkübasyonu takip etti. Amplikonlar (1.0%) agarose gel electrophoresis görüntü cihazı ImageMaster ® VDS ile analiz edildi.Cloning and DNA sequencing of Der f 1: Cloning and DNA sequencing of Der f 1 Der f 1 gen fragment kodlamasını elde etmek üzere yukarıdaki amplikonlar kalıp gibi uygulandı ve ikinci PCR da PrimeSTARTM HS DNA Polymerase kit i ( TaKaRa ) ile birlikte F ve R primerleri kullanıldı.Cloning and DNA sequencing of Der f 1: Cloning and DNA sequencing of Der f 1 Reaksiyon başına 50 μ l lik son hacimin bleşenlerinin dağılımları 20 pmol F ve R herbiri ( 0.5 μl ), the above amplicons ( 1 μl ), 2×PrimerSTARTM Buffer ( 25 μl ), 2.5 mM of the Dntp Mixture ( 2 μl ), 2.5 U/μl of the PrimeSTARTM HS DNA Polymerase ( 0.5 μl ), and the DEPC H2O ( 18.5μl )Cloning and DNA sequencing of Der f 1: Cloning and DNA sequencing of Der f 1 PCR Thermal Cycler Dice da Başlangıç inkübasyonu 5 min at 94oC Takip eden 30 döngü 10 s 98oC, 10 s at 57oC, ve 1 min 72oC Son inkübasyon ise 5 min 72oC Elde edilen PCR ürünleri agarose gel electrophoresis (1.0%) with ImageMaster ®VDS da analiz edildi.Cloning and DNA sequencing of Der f 1: Cloning and DNA sequencing of Der f 1 PCR amplifikasyon ve jel elektroforezinden sonra DNA, agaroz jel DNA izolasyon kiti Ver.2.0( TaKaRa ) ile Jelden kurtarıldı.Cloning and DNA sequencing of Der f 1: Cloning and DNA sequencing of Der f 1 Arındırılmış DNA ya DNA A-Tailing Kit adında bir poly A kuyruğu (TaKaRa) ve refine DNA ile fragment izolasyon kiti Ver.2.0 (TaKaRa) eklenmiştir.Cloning and DNA sequencing of Der f 1: Cloning and DNA sequencing of Der f 1 Klonlanmış genlerin fragmanları daha sonra plasmid pMD19-T a bağlandı.Cloning and DNA sequencing of Der f 1: Cloning and DNA sequencing of Der f 1 Recombinant plasmitler E. Coli JM109 a transforme oldu100 μg/ml ampicillin içeren plakalarda blue/white screening ile Luria-Bertani de identifiye edildi.: 100 μg /ml ampicillin içeren plakalarda blue/white screening ile Luria- Bertani de identifiye edildi.Cloning and DNA sequencing of Der f 1: Cloning and DNA sequencing of Der f 1 Plasmitler MiniBEST Plasmid izolasyon kiti ( Plasmid Purification Kit 70 ) ile saflaştırıldı.Cloning and DNA sequencing of Der f 1: Cloning and DNA sequencing of Der f 1 Eklenmiş DNA restriksiyon analizi ile doğrulandı DNA dizisi MegaBACE 1, 000 DNA sequencerda BcaBEST M13-47 primeri ile ileri ve BcaBEST RV-M primeri ile de geri yürütüldü.Cloning and DNA sequencing of Der f 1: Cloning and DNA sequencing of Der f 1 Plazmit BamHI ve XhoI ile kesimden sonra ImageMaster ® agaroz jel elektroforezde (1.0%) analiz edildi.Cloning and DNA sequencing of Der f 2: Cloning and DNA sequencing of Der f 2 Der f2 için cDNA nın kodlanmasının PCR amplifikasyonuna Genbank (AB195580) dan 2 primer tasarlandı F( BamHI 5’ GGATCC ATGATTTCCAAAATCTTGTGCCTTTC3’) R ( XhoI 5’ CTCGAG TTAATCACGGATTTTACCAT GGG 3’)Cloning and DNA sequencing of Der f 2: Cloning and DNA sequencing of Der f 2 Öncelikle PCR Thermal Cycler Dice de 3’-Full RACE Core Set Ver.2.0 ile kalıp RNAnın reverse transcription u yapıldı (30dak).Cloning and DNA sequencing of Der f 2: Cloning and DNA sequencing of Der f 2 Her bileşenin son konsantrasyonu reaksiyon başına aşağıdaki gibi idi: ( 10 ul son hacim Total RNA ( 3 μl ) , 10×RNA PCR Buffer ( 1 μl ), 10 mM of the dNTP Mixture ( 1 μl ), 25mM of MgCl2 ( 2 μl ), 5 U/μl of the M-MLV Reverse Transcriptase XL ( 0.25 μ l ), 40 U μ l of the RNase Inhibitor ( 0.25 μl ), 20 pmol of primer R ( 0.5 μl ), Random primer ( 1 μl ) DEPC H2O ( 1 μl ).PowerPoint Presentation: İkinci olarak RT ürünleri PCR için kalıp olarak kullanıldı aynı şekilde thermal Cycler Dice ile birlikte bir başlangıç inkübasyonu 3 dk da 94 oC, takibeden 30 döngünün 30s i 94 o C, 30 s 55 o C ve 1 dk da 72 o C sürdü.Cloning and DNA sequencing of Der f 2: Cloning and DNA sequencing of Der f 2 Reaksiyon sistemi RT ürünleri dahil ( 2 ul ), 2 × GC Tampon ( 5 mM Mg2 + den, 25 mikrolitre ), 5 U / ul LA Taq ( 0.5 mikrolitre ), 1 × cDNA'nın dilüsyon Buffer ( 8 ul ), her biri 20 pmol olan F ve R ( 1 er mikrolitre ) dH 2 O ( 12.5 ul ). PCR amplifikasyon ürünleri plazmid pMD19-T içine ligasyonu ile klonlanmış oldu.Cloning and DNA sequencing of Der f 2: Cloning and DNA sequencing of Der f 2 Luria- Bertani (LB) 100 μg /ml ampicillin içeren petrilerde Recombinant plasmitler E . coli kompetent hücreleri JM109 içine transforme oldu ve blue/white selection yapıldı.Cloning and DNA sequencing of Der f 2: Cloning and DNA sequencing of Der f 2 Eklenmiş DNA nın durumu restriksiyon analizi ile ve BcaBEST M13-47 ileri primeri ile BcaBEST RV-M revers primeri MegaBACE da 1000 DNA sequence rda DNA dizilimi doğrulandı . Restriksiyon enzimleri BamHI ve Xhol ile DNA kesildikten sonra standart tekniklerle agaroz jelde elektroforetik analizi yapıldı.Phylogenetic tree construction: Phylogenetic tree construction Derf1 ve Derf2 nin her ikisinn de amino asit dizileri cDNA sekanslarından Translate Tools aracılığıyla çıkarıldı.Phylogenetic tree construction: Phylogenetic tree construction NCBI (National Center for Biotechnology Information) da Bunların homolog benzerlikleri, çıkarılan aminoasit sekansalarının GenBank CDS translations+PDB+ SwissProt+PIR+PRF kullanılarak karşılaştırılması ile ortaya çıktı.Phylogenetic tree construction: Phylogenetic tree construction D. pteronyssinus , E. maynei nin VECTOR NTI 9.0 Yazılım ile transle olan amino asit sekansları kullanılarak format Fasta ile benzerlikleri analiz edildi. Filogenetik ağaçlar mega 3.0 ile inşa edildi.Results Analysis of the nested-PCR products for Der f 1 by agarose electrophoresis.: Results Analysis of the nested-PCR products for Der f 1 by agarose electrophoresis . M,DNA Marker DL2, 000. 1, RT-PCR ürünü 966 bpRestriction enzyme analysis of the recombinant plasmids pMD19-T-Der f 1.: Restriction enzyme analysis of the recombinant plasmids pMD19-T-Der f 1. Lane M1, l-Hind l DNA Marker; lane M2, DNA Marker DL2,000; lane 1 and 2, recombinant plasmids were digested with BamHI and XhoI .The translated amino acid sequence of Hainan Der f 1 allergen.: The translated amino acid sequence of Hainan Der f 1 allergen . On the basis of the cDNA sequence of Hainan group 1 allergen, its amino acid sequence was deduced using Translate ToolsRestriction enzyme analysis of the recombinant plasmids pMD19-T-Der f 2.: Restriction enzyme analysis of the recombinant plasmids pMD19-T-Der f 2. Lane M1, l-Hind l DNA Marker; lane M2, DNA Marker DL2,000; lane 1 and 2, recombinant plasmids were digested with BamHI and XhoI NCBI Web sunucusunun ORF( mRNA da protein şifreleyen bölgeler) Bulucu ile tam bir ORF bulundu ve başlama kodonu ATG den bitiş kodonu TGA ya kadar tüm uzunluk 528 bps bulundu.The translated amino acid sequence of Hainan Der f 2 allergen.: The translated amino acid sequence of Hainan Der f 2 allergen . On the basis of the cDNA sequence of Hainan group 2 allergen, its amino acid sequence was deduced with use of Translate Tools (http://www. expasy.org).Similarity and phylogenetic analysis of house dust mite: Similarity and phylogenetic analysis of house dust mite Grup1 ve grup2 allerjenlerin en çok benzeyen dizileri için en yaygın akar türleri, NCBI de Blastp programıyla analiz etmek için seçildi .PowerPoint Presentation: Allergens Aksesyon kodu Benzerlik E değeri(10,000) References EUR m1 P25780 86.0% 2.5e-161 Smith ,W., et al.(1999) Der p 1 P08176 82.9% 4.2e-155 Chua ,K.Y., et al (1993) Pso o 1 CAK32515 65.2% 3e-122 Nisbet ,A.J.(2007) EUR m2 AAC82350 82.6% 6.8e-57 Smith ,W., et al (1999) Der p 2 ABA39437 87.6% 1.2e-60 Piboonpocanun ,S.et al.(2006) Pso o 2 Q965E2 40.7% 1.4e-26 Temeyer ,K.B., et al.(2002)Amino acid sequence similarity for group 1 allergens of the most common house dust mites.: Amino acid sequence similarity for group 1 allergens of the most common house dust mites. Der f 1 Der p 1 Eur m I Pso o 1 Der f 1 83 84 65 Der p 1 86 63 Eur m I 64 Pso o 1 by VCETOR NTI 9.0 softwareAmino acid sequence similarity for group 2 allergens of the most common house dust mites: Amino acid sequence similarity for group 2 allergens of the most common house dust mites Der f 2 Der p 2 EUR m2 Pso o 2 Der f 2 68 67 31 Der p 2 87 44 EUR m2 46 Pso o 2A phylogenetic tree for group 1 allergens of different house dust mite species.: A phylogenetic tree for group 1 allergens of different house dust mite species . After alignment of the indicated group 1 allergens, a phylogenetic tree was constructed as described in “Materials and Methods”.A phylogenetic tree for group 2 allergens of different house dust mite-species.: A phylogenetic tree for group 2 allergens of different house dust mite- species . After alignment of the indicated group 2 allergens, a phylogenetic tree was constructed as described in “Materials and Methods”.Sonuç : Sonuç Her iki genin fragmentleri grup1 ve grup2 allerjenlerin ikisinin de D. P teronyssinus un E. maynei ye D. farinae den daha çok benzediğini göstermiştir. Özellikle Derp1 ve Derp2 aynı cinsin iki türü ne ait allerjenler olmasına karşın filogenetik olarak birlikte bulunamamıştır.HAİKOU: HAİKOU You do not have the permission to view this presentation. In order to view it, please contact the author of the presentation.
KH-Central European Journal of Medicine [Kurtarılan] kadriye Download Post to : URL : Related Presentations : Share Add to Flag Embed Email Send to Blogs and Networks Add to Channel Uploaded from authorPOINT lite Insert YouTube videos in PowerPont slides with aS Desktop Copy embed code: (To copy code, click on the text box) Embed: URL: Thumbnail: WordPress Embed Customize Embed The presentation is successfully added In Your Favorites. Views: 40 Category: Science & Tech.. License: All Rights Reserved Like it (0) Dislike it (0) Added: January 05, 2012 This Presentation is Public Favorites: 0 Presentation Description No description available. Comments Posting comment... Premium member Presentation Transcript Central European Journal of Medicine Phylogenetic analysis of house dust mites: Central European Journal of Medicine Phylogenetic analysis of house dust mites Yubao Cui1,2,3*, Cuixiang Gao1, Ying Zhou1, Peng Zhou2, Ming Peng2, Yingzi Lin3, Jianglong Peng3 Received 18 June 2009; Accepted 4 August 2009Makalenin Önemi : Makalenin Önemi Ev tozu akarları ev tozlarında bulunup vücut parçaları ve özellikle dışkılarında bulunan allerjenler sebebiyle insanlarda astım alerjik rinit atopik dermatid kronik ürtikerMakalede Amaç : Makalede Amaç Ev tozlarında en yoğun olarak bulunan (%90) Dermatophagoides farinae , Dermatophagoides pteronyssinus Euroglyphus maynei üç tür arasında filogenetik ilişkiyi keşfetmek Giriş: Giriş Mite lar yaklaşık yarım mm boyunda krem beyaz renginde Arachnida sınıfındaki arthropodlardır. Dünyada 30 farklı cinsi bulunmuş ve kaydedilmiştir. 30Giriş: Giriş Ev tozu akarları alerjenlerinin en önemlileri grup1 ve grup2 alerjenlerin olduğu kaydedilmiştir. Bu alerjenler sistein proteazı ve HE1 homolojisine sahip allerjenler familyasına mensupturlar.Giriş: Giriş Ev tozu akarlarıyla ilgili filogenetik çalışmalar bulunmasına karşın her iki allerjenin sekanslarının birlikte bulunduğu çalışma yoktur ve bu üç akarın ortak olarak yer aldığı çalışmalar da çok azdır.Grup1 ve Grup2 allerjenlerinin sekansları kullanılarak aralarındaki filogenetik ilişki yorumlanmıştır.: Grup1 ve Grup2 allerjenlerinin sekansları kullanılarak aralarındaki filogenetik ilişki yorumlanmıştır. Dermatophagoides pteronyssinus Dermatophagoides farinae Euroglyphus mayneiMaterial and Method: Material and Method D. farinae kültürü ve izolasyonu Total RNA izolasyonu Der f1 in DNA sekansı ve klonlanması Der f2 in DNA sekansı ve klonlanması Filogenetik ağaç yapımıD. farinae culture and isolation of adult mites: D. farinae culture and isolation of adult mites EV TOZU % 75 bağıl nem 25oC sıcaklık Maya Buğday unu pirinç KÜLTÜR ORTAMI D. farinae 600 MİTE RNA İSOLATİON akarlar larvalar arthrefatlar Çin Halk Cumhuriyeti HaikouTotal RNA isolation: Total RNA isolation Yaklaşık 600 ergin canlı akar likit nitrojen ile hızla donduruldu ve 1ml RNA izolatör eklendi. RNAiso içindeki akarlar Bir Powergen 125 Doku Homojenizatörü ile homojenize edildi.Total RNA isolation: Total RNA isolation Oda sıcaklığında 30 ila 60 saniyelik bir süre içinde 5000 RPM başlayarak yaklaşık 20.000 RPM e kadar kademeli bir artış ile homojenize oldu.Total RNA isolation: Total RNA isolation Homojenizasyondan sonra , tüm mataryaller Doku Homojenizatöründen bir eppendorf tüpe transfer edildi ve 0.2ml kloroform eklendi. üreticinin protokolüne göre Yetişkin D. farinae lerden RNA ekstrakte edildi.Cloning and DNA sequencing of Der f 1: Cloning and DNA sequencing of Der f 1 N ested -PCR la Der f 1 geni amplifikasyonu için GenBank AB034946 içinden F(5’ bamHI GGATCC ATGAAATTCGTTTTGGCCATTG3’), R0(5’TCGCAAGAGTAGTTGTTTTTAT3’), R(5’ CTCGAG TCACATGATTACAACATATGGATATT3’ Xhol )Cloning and DNA sequencing of Der f 1: Cloning and DNA sequencing of Der f 1 Öncelikle revers transkiripsiyon polimeraz zincir reaksiyonu (RT-PCR) amplifikasyonuna kalıp olarak total RNA , One Step RNA PCR Kit i ( TaKaRa ) ile performe edildi.Cloning and DNA sequencing of Der f 1: Cloning and DNA sequencing of Der f 1 Reaksiyon başına 50 μ l lik son hacimin bleşenlerinin dağılımları 20 pmol F ve R0 primer lerinin herbiri ( 1 er μl ) total RNA ( 4 μl ), 2×One Step RNA PCR Buffer ( 25 μl ) 2.5mM dNTP Mixture ( 2 μl ) 40 u/μl RNase Inhibitor ( 1 μ l ) 5 U/μl M-MLV Reverse Transcriptase XL ( 0.5 μ l ) 5 U/ul Ex Taq ( 1 μl ) DEPC H2O ( 14.5 μ l )Cloning and DNA sequencing of Der f 1: Cloning and DNA sequencing of Der f 1 RT-PCR, PCR Thermal Cycler Dice ( TaKaRa ) da 30 dk 50oC RT performe edildi ve 2 dk 94oC başlangıç inkibasyonunu 30 döngü 15 s 98oC, 30 s 57oC ve 1 dk 72oC uzama inkübasyonu 5 dk 72oC final inkübasyonu takip etti. Amplikonlar (1.0%) agarose gel electrophoresis görüntü cihazı ImageMaster ® VDS ile analiz edildi.Cloning and DNA sequencing of Der f 1: Cloning and DNA sequencing of Der f 1 Der f 1 gen fragment kodlamasını elde etmek üzere yukarıdaki amplikonlar kalıp gibi uygulandı ve ikinci PCR da PrimeSTARTM HS DNA Polymerase kit i ( TaKaRa ) ile birlikte F ve R primerleri kullanıldı.Cloning and DNA sequencing of Der f 1: Cloning and DNA sequencing of Der f 1 Reaksiyon başına 50 μ l lik son hacimin bleşenlerinin dağılımları 20 pmol F ve R herbiri ( 0.5 μl ), the above amplicons ( 1 μl ), 2×PrimerSTARTM Buffer ( 25 μl ), 2.5 mM of the Dntp Mixture ( 2 μl ), 2.5 U/μl of the PrimeSTARTM HS DNA Polymerase ( 0.5 μl ), and the DEPC H2O ( 18.5μl )Cloning and DNA sequencing of Der f 1: Cloning and DNA sequencing of Der f 1 PCR Thermal Cycler Dice da Başlangıç inkübasyonu 5 min at 94oC Takip eden 30 döngü 10 s 98oC, 10 s at 57oC, ve 1 min 72oC Son inkübasyon ise 5 min 72oC Elde edilen PCR ürünleri agarose gel electrophoresis (1.0%) with ImageMaster ®VDS da analiz edildi.Cloning and DNA sequencing of Der f 1: Cloning and DNA sequencing of Der f 1 PCR amplifikasyon ve jel elektroforezinden sonra DNA, agaroz jel DNA izolasyon kiti Ver.2.0( TaKaRa ) ile Jelden kurtarıldı.Cloning and DNA sequencing of Der f 1: Cloning and DNA sequencing of Der f 1 Arındırılmış DNA ya DNA A-Tailing Kit adında bir poly A kuyruğu (TaKaRa) ve refine DNA ile fragment izolasyon kiti Ver.2.0 (TaKaRa) eklenmiştir.Cloning and DNA sequencing of Der f 1: Cloning and DNA sequencing of Der f 1 Klonlanmış genlerin fragmanları daha sonra plasmid pMD19-T a bağlandı.Cloning and DNA sequencing of Der f 1: Cloning and DNA sequencing of Der f 1 Recombinant plasmitler E. Coli JM109 a transforme oldu100 μg/ml ampicillin içeren plakalarda blue/white screening ile Luria-Bertani de identifiye edildi.: 100 μg /ml ampicillin içeren plakalarda blue/white screening ile Luria- Bertani de identifiye edildi.Cloning and DNA sequencing of Der f 1: Cloning and DNA sequencing of Der f 1 Plasmitler MiniBEST Plasmid izolasyon kiti ( Plasmid Purification Kit 70 ) ile saflaştırıldı.Cloning and DNA sequencing of Der f 1: Cloning and DNA sequencing of Der f 1 Eklenmiş DNA restriksiyon analizi ile doğrulandı DNA dizisi MegaBACE 1, 000 DNA sequencerda BcaBEST M13-47 primeri ile ileri ve BcaBEST RV-M primeri ile de geri yürütüldü.Cloning and DNA sequencing of Der f 1: Cloning and DNA sequencing of Der f 1 Plazmit BamHI ve XhoI ile kesimden sonra ImageMaster ® agaroz jel elektroforezde (1.0%) analiz edildi.Cloning and DNA sequencing of Der f 2: Cloning and DNA sequencing of Der f 2 Der f2 için cDNA nın kodlanmasının PCR amplifikasyonuna Genbank (AB195580) dan 2 primer tasarlandı F( BamHI 5’ GGATCC ATGATTTCCAAAATCTTGTGCCTTTC3’) R ( XhoI 5’ CTCGAG TTAATCACGGATTTTACCAT GGG 3’)Cloning and DNA sequencing of Der f 2: Cloning and DNA sequencing of Der f 2 Öncelikle PCR Thermal Cycler Dice de 3’-Full RACE Core Set Ver.2.0 ile kalıp RNAnın reverse transcription u yapıldı (30dak).Cloning and DNA sequencing of Der f 2: Cloning and DNA sequencing of Der f 2 Her bileşenin son konsantrasyonu reaksiyon başına aşağıdaki gibi idi: ( 10 ul son hacim Total RNA ( 3 μl ) , 10×RNA PCR Buffer ( 1 μl ), 10 mM of the dNTP Mixture ( 1 μl ), 25mM of MgCl2 ( 2 μl ), 5 U/μl of the M-MLV Reverse Transcriptase XL ( 0.25 μ l ), 40 U μ l of the RNase Inhibitor ( 0.25 μl ), 20 pmol of primer R ( 0.5 μl ), Random primer ( 1 μl ) DEPC H2O ( 1 μl ).PowerPoint Presentation: İkinci olarak RT ürünleri PCR için kalıp olarak kullanıldı aynı şekilde thermal Cycler Dice ile birlikte bir başlangıç inkübasyonu 3 dk da 94 oC, takibeden 30 döngünün 30s i 94 o C, 30 s 55 o C ve 1 dk da 72 o C sürdü.Cloning and DNA sequencing of Der f 2: Cloning and DNA sequencing of Der f 2 Reaksiyon sistemi RT ürünleri dahil ( 2 ul ), 2 × GC Tampon ( 5 mM Mg2 + den, 25 mikrolitre ), 5 U / ul LA Taq ( 0.5 mikrolitre ), 1 × cDNA'nın dilüsyon Buffer ( 8 ul ), her biri 20 pmol olan F ve R ( 1 er mikrolitre ) dH 2 O ( 12.5 ul ). PCR amplifikasyon ürünleri plazmid pMD19-T içine ligasyonu ile klonlanmış oldu.Cloning and DNA sequencing of Der f 2: Cloning and DNA sequencing of Der f 2 Luria- Bertani (LB) 100 μg /ml ampicillin içeren petrilerde Recombinant plasmitler E . coli kompetent hücreleri JM109 içine transforme oldu ve blue/white selection yapıldı.Cloning and DNA sequencing of Der f 2: Cloning and DNA sequencing of Der f 2 Eklenmiş DNA nın durumu restriksiyon analizi ile ve BcaBEST M13-47 ileri primeri ile BcaBEST RV-M revers primeri MegaBACE da 1000 DNA sequence rda DNA dizilimi doğrulandı . Restriksiyon enzimleri BamHI ve Xhol ile DNA kesildikten sonra standart tekniklerle agaroz jelde elektroforetik analizi yapıldı.Phylogenetic tree construction: Phylogenetic tree construction Derf1 ve Derf2 nin her ikisinn de amino asit dizileri cDNA sekanslarından Translate Tools aracılığıyla çıkarıldı.Phylogenetic tree construction: Phylogenetic tree construction NCBI (National Center for Biotechnology Information) da Bunların homolog benzerlikleri, çıkarılan aminoasit sekansalarının GenBank CDS translations+PDB+ SwissProt+PIR+PRF kullanılarak karşılaştırılması ile ortaya çıktı.Phylogenetic tree construction: Phylogenetic tree construction D. pteronyssinus , E. maynei nin VECTOR NTI 9.0 Yazılım ile transle olan amino asit sekansları kullanılarak format Fasta ile benzerlikleri analiz edildi. Filogenetik ağaçlar mega 3.0 ile inşa edildi.Results Analysis of the nested-PCR products for Der f 1 by agarose electrophoresis.: Results Analysis of the nested-PCR products for Der f 1 by agarose electrophoresis . M,DNA Marker DL2, 000. 1, RT-PCR ürünü 966 bpRestriction enzyme analysis of the recombinant plasmids pMD19-T-Der f 1.: Restriction enzyme analysis of the recombinant plasmids pMD19-T-Der f 1. Lane M1, l-Hind l DNA Marker; lane M2, DNA Marker DL2,000; lane 1 and 2, recombinant plasmids were digested with BamHI and XhoI .The translated amino acid sequence of Hainan Der f 1 allergen.: The translated amino acid sequence of Hainan Der f 1 allergen . On the basis of the cDNA sequence of Hainan group 1 allergen, its amino acid sequence was deduced using Translate ToolsRestriction enzyme analysis of the recombinant plasmids pMD19-T-Der f 2.: Restriction enzyme analysis of the recombinant plasmids pMD19-T-Der f 2. Lane M1, l-Hind l DNA Marker; lane M2, DNA Marker DL2,000; lane 1 and 2, recombinant plasmids were digested with BamHI and XhoI NCBI Web sunucusunun ORF( mRNA da protein şifreleyen bölgeler) Bulucu ile tam bir ORF bulundu ve başlama kodonu ATG den bitiş kodonu TGA ya kadar tüm uzunluk 528 bps bulundu.The translated amino acid sequence of Hainan Der f 2 allergen.: The translated amino acid sequence of Hainan Der f 2 allergen . On the basis of the cDNA sequence of Hainan group 2 allergen, its amino acid sequence was deduced with use of Translate Tools (http://www. expasy.org).Similarity and phylogenetic analysis of house dust mite: Similarity and phylogenetic analysis of house dust mite Grup1 ve grup2 allerjenlerin en çok benzeyen dizileri için en yaygın akar türleri, NCBI de Blastp programıyla analiz etmek için seçildi .PowerPoint Presentation: Allergens Aksesyon kodu Benzerlik E değeri(10,000) References EUR m1 P25780 86.0% 2.5e-161 Smith ,W., et al.(1999) Der p 1 P08176 82.9% 4.2e-155 Chua ,K.Y., et al (1993) Pso o 1 CAK32515 65.2% 3e-122 Nisbet ,A.J.(2007) EUR m2 AAC82350 82.6% 6.8e-57 Smith ,W., et al (1999) Der p 2 ABA39437 87.6% 1.2e-60 Piboonpocanun ,S.et al.(2006) Pso o 2 Q965E2 40.7% 1.4e-26 Temeyer ,K.B., et al.(2002)Amino acid sequence similarity for group 1 allergens of the most common house dust mites.: Amino acid sequence similarity for group 1 allergens of the most common house dust mites. Der f 1 Der p 1 Eur m I Pso o 1 Der f 1 83 84 65 Der p 1 86 63 Eur m I 64 Pso o 1 by VCETOR NTI 9.0 softwareAmino acid sequence similarity for group 2 allergens of the most common house dust mites: Amino acid sequence similarity for group 2 allergens of the most common house dust mites Der f 2 Der p 2 EUR m2 Pso o 2 Der f 2 68 67 31 Der p 2 87 44 EUR m2 46 Pso o 2A phylogenetic tree for group 1 allergens of different house dust mite species.: A phylogenetic tree for group 1 allergens of different house dust mite species . After alignment of the indicated group 1 allergens, a phylogenetic tree was constructed as described in “Materials and Methods”.A phylogenetic tree for group 2 allergens of different house dust mite-species.: A phylogenetic tree for group 2 allergens of different house dust mite- species . After alignment of the indicated group 2 allergens, a phylogenetic tree was constructed as described in “Materials and Methods”.Sonuç : Sonuç Her iki genin fragmentleri grup1 ve grup2 allerjenlerin ikisinin de D. P teronyssinus un E. maynei ye D. farinae den daha çok benzediğini göstermiştir. Özellikle Derp1 ve Derp2 aynı cinsin iki türü ne ait allerjenler olmasına karşın filogenetik olarak birlikte bulunamamıştır.HAİKOU: HAİKOU