RESTRICTION FRAGMENT LENGTH POLYMORPHISM (RFLP)

Views:
 
Category: Education
     
 

Presentation Description

No description available.

Comments

By: pks26 (102 month(s) ago)

i am life sciences student.can u plz mail this presentation to me thanks

By: CHICH (106 month(s) ago)

I am Chirine. A genetic engineer student. Can you kindly email me this presentation? Thank you and Regards,

By: ayesha5 (107 month(s) ago)

please email me this presentation

By: ghosh.mayukh87 (108 month(s) ago)

the rflp presentation is very nice. can you send me the presentation to my email id please?

Presentation Transcript

Slide 1: 

Isolate DNA RE (4 GENOTYPES) V1 V2 V3 V4 Prehybridization Three probes Scoring Feeding to computer Analysis Blocking RFLP Restriction Fragment Length Polymorphism

Slide 2: 

Sponge Dry Tissue Papers Weight Southern Blotting (Southern, 1975) Gel DNA Nitrocellulose membrane Animated S-Blot

Slide 3: 

Probing / Hybridization Animated S-Blot

Slide 4: 

How do we get polymorphism? Substitution leads to RFLP………………… AGCTTATTCGGATTCAAGGATCCTTCGGATTCAACTA MUTATED G to T AGCTTATTCGTATTCAAGGATCCTTCGG ATTCAACTA RESTRICTION FRAGMENTS AGCTTATTCGGTTTCAAGGATCCTTCGGATTCAACTA Results into Restriction Fragment Length POLYMOPRPHISM deletion insertion and/or transposition or error in DNA replication ACT IN THE SAME WAY © A.K. Chhabra

Slide 5: 

RFLP markers arise as a result of Mutations: substitution of a single nucleotide rearrangements in the DNA intervening between two restriction sires Such rearrangements might include deletion insertion and/or transposition or error in DNA replication. © A.K. Chhabra

Slide 6: 

How Substitution leads to RFLP………………… AGCTTATTCGGATTCAAGGATCCTTCGGATTCAACTA MUTATED G to T AGCTTATTCGTATTCAAGGATCCTTCGG ATTCAACTA RESTRICTION FRAGMENTS AGCTTATTCGGTTTCAAGGATCCTTCGGATTCAACTA Results into Restriction Fragment Length POLYMOPRPHISM deletion insertion and/or transposition or error in DNA replication ACT IN THE SAME WAY © A.K. Chhabra

Slide 7: 

RFLP Technique DNA isolation (text file) Digestion of the DNA with a restriction enzyme Separation of the restricted fragments by agarose gel electrophoresis/PAGE Southern Blotting Detection of individual restriction fragments by nucleic acid hybridization with labeled cloned probes, Scoring of RFLPs by direct observation of autoradiograms. © A.K. Chhabra RFLP ANIMATED

authorStream Live Help