Randomly Amplified Polymorphic DNA

Views:
 
Category: Education
     
 

Presentation Description

No description available.

Comments

By: galileo31 (115 month(s) ago)

very nice presentation thanks !! can u allow downloading a presentation?

Presentation Transcript

Slide 1: 

Principle AGCTTTACTTCATGCATTCCGATCAGATGTAAATAC TCGAAATGAAGTACGTAAGGCTAGTCTACATTTATG V1 V2 V3 V4 V1 V2 V3 V4 RAPD Randomly Amplified Polymorphic DNA

Slide 2: 

…….AGCTAATCTAGAGAGAGAGAGAGCTAGCTGATTCAACTAC……. …….TCGATTAGATCTCTCTCTCTCTCGATCGACTATGTTGATG……. New strand CTCGATCGAC New strand RAPD No cloning required No sequencing required Random primer of about 10 bp Detects several loci simultaneously Dominant marker Useful for phylogenetic studies Short primers are easily affected by annealing conditions thus are not reproducible Not useful for comparative mapping CTCGATCGAC

Slide 3: 

RAPD In this technique ………………… a single species of primer (10-base, at least 60%GC content) binds to the genomic DNA at two different sites on opposite strands of the DNA template. If these priming sites are within an amplifiable distance (2000 to 5000 bp) of each other, a discrete DNA product is produced through thermocyclic (PCR) amplification. The amplification yields many DNA fragments ranging in size from less than 100 bp to greater than 2 kb. These fragments are anonymous in the sense that their genomic origins are not known. Differences in the fragment patterns amplified from each genomic DNA sample are generally attributed to mutation at primer binding sites preventing the annealing of a primer. © A.K. Chhabra

authorStream Live Help