logging in or signing up RFLP S-Blotting chhabra61 Download Post to : URL : Related Presentations : Share Add to Flag Embed Email Send to Blogs and Networks Add to Channel Uploaded from authorPOINT lite Insert YouTube videos in PowerPont slides with aS Desktop Copy embed code: (To copy code, click on the text box) Embed: URL: Thumbnail: WordPress Embed Customize Embed The presentation is successfully added In Your Favorites. Views: 118 Category: Education License: All Rights Reserved Like it (0) Dislike it (0) Added: September 26, 2010 This Presentation is Public Favorites: 0 Presentation Description No description available. Comments Posting comment... By: ayesha5 (15 month(s) ago) please email me this presentation Saving..... Post Reply Close Saving..... Edit Comment Close Premium member Presentation Transcript Slide 1: How Substitution leads to RFLP………………… AGCTTATTCGGATTCAAGGATCCTTCGGATTCAACTA MUTATED G to T AGCTTATTCGTATTCAAGGATCCTTCGG ATTCAACTA RESTRICTION FRAGMENTS AGCTTATTCGGTTTCAAGGATCCTTCGGATTCAACTA Results into Restriction Fragment Length POLYMOPRPHISM deletion insertion and/or transposition or error in DNA replication ACT IN THE SAME WAY Slide 2: Sponge Dry Tissue Papers Weight Southern Blotting (Southern, 1975) Gel DNA Nitrocellulose membrane Animated S-Blot Slide 3: Probing / Hybridization Animated S-Blot You do not have the permission to view this presentation. In order to view it, please contact the author of the presentation.
RFLP S-Blotting chhabra61 Download Post to : URL : Related Presentations : Share Add to Flag Embed Email Send to Blogs and Networks Add to Channel Uploaded from authorPOINT lite Insert YouTube videos in PowerPont slides with aS Desktop Copy embed code: (To copy code, click on the text box) Embed: URL: Thumbnail: WordPress Embed Customize Embed The presentation is successfully added In Your Favorites. Views: 118 Category: Education License: All Rights Reserved Like it (0) Dislike it (0) Added: September 26, 2010 This Presentation is Public Favorites: 0 Presentation Description No description available. Comments Posting comment... By: ayesha5 (15 month(s) ago) please email me this presentation Saving..... Post Reply Close Saving..... Edit Comment Close Premium member Presentation Transcript Slide 1: How Substitution leads to RFLP………………… AGCTTATTCGGATTCAAGGATCCTTCGGATTCAACTA MUTATED G to T AGCTTATTCGTATTCAAGGATCCTTCGG ATTCAACTA RESTRICTION FRAGMENTS AGCTTATTCGGTTTCAAGGATCCTTCGGATTCAACTA Results into Restriction Fragment Length POLYMOPRPHISM deletion insertion and/or transposition or error in DNA replication ACT IN THE SAME WAY Slide 2: Sponge Dry Tissue Papers Weight Southern Blotting (Southern, 1975) Gel DNA Nitrocellulose membrane Animated S-Blot Slide 3: Probing / Hybridization Animated S-Blot