logging in or signing up Biodiversity IPR extended chhabra61 Download Post to : URL : Related Presentations : Share Add to Flag Embed Email Send to Blogs and Networks Add to Channel Uploaded from authorPOINT lite Insert YouTube videos in PowerPont slides with aS Desktop Copy embed code: (To copy code, click on the text box) Embed: URL: Thumbnail: WordPress Embed Customize Embed The presentation is successfully added In Your Favorites. Views: 48 Category: Education License: All Rights Reserved Like it (1) Dislike it (0) Added: September 26, 2010 This Presentation is Public Favorites: 0 Presentation Description No description available. Comments Posting comment... Premium member Presentation Transcript Slide 1: BIODIVERSITY GROUP V.K. Gour, JNKVV, Jabalpur A.K. Chhabra, CCSHAU, Hisar P.K. Barua, AAU, Jorhat, Assam Hulas Pathak, IGAU, Raipur Sunil Umate, Maharashtra BIODIVERSITY CONSERVATION & IPR PERSPECTIVE: A CASE STUDY OF MEDICINAL PLANTS IPR in Relation to Agriculture and Allied Fields Slide 2: A conservative working estimate suggests that there might be around 12.5 million species on this earth. 1.7 million species have been described to date SOME FACTS GLOBAL Total number of species existing on earth at present vary from 25 million to nearly 100 million. Slide 3: Contd………… Slide 6: 49 major crop species domesticated Around 583 plant species are reported to be cultivated in India 334 species wild relatives of crop species (Arora, 1991, Paroda, et al. 1998) Slide 7: India is floristically very rich and hence counted among the of the world. One of the 12 mega centers of biodiversity megabiodiversity centers Has two of the eight hotspots (western ghat and northeast region) Slide 8: The country ranks tenth among the plant-rich nations of the world -- fourth amongst the countries of Asia FACTS INDIA Slide 9: Our Strength: The bio- richness Source: K.P. Singh (2005) FLORA Flowering plants (angiosperms) 15000-18000 Medicinal plants 1500 species Cultivated plants 160 species FAUNA Domestic Animals 450 m heads Cattles (26 breeds); Buffaloes(8 breeds); Sheep (40 breeds); Goats (20 breeds); Camels (8 br.); Horses (6 breeds); Poultry (18 Breeds) Microbes Slide 10: Demand for medicinal plant is increasing in both developing and developed countries due to rising appreciation of natural products, being non-toxic, having no side-effects, easily available and affordable, and sometime the only source of health care available to the poor Slide 11: The World Health Organization (WHO) estimated that about 80% of the population of developing countries rely on traditional medicines derived from plants, for primary health care. WHO Data from Internet Slide 12: Modern pharmaceuticals still contains at least 25% drugs derived from plants and many others which are synthetic analogue built on prototype compounds isolated from plants (Natesh 2001). Slide 13: There are estimated to be over manufacturing units in India (Natesh 2001) 7800 pharmaceuticals Slide 14: Because of: infrastructural development, growth-exploitation, environment-unfriendly harvesting techniques, loss of growth habitats and unmonitored trade of medicinal plants. Threat of extinction That’s why there is a need for conservation? Slide 15: Irreversible loss of biological diversity: extinction of species The natural or "background" rate of extinction 1-10 species a year. Slide 16: Present extinction rates have accelerated this century to at least 1,000 species per year and may climb to 10,000 times the background rate during the next century, if present trends continue. PROTECTED Extinction Slide 17: 100 Red-Listed Medicinal Plants of Conservation Concern in Southern India K. Ravi Kumar and D.K. Ved. Bangalore, Foundation for Revitalisation of Local Health Traditions (FRLHT), 2000, 467 p., tables, plates, maps. Rare, Endangered and Threatened and meet the criteria for RED LISTING. Slide 18: Threat of bio-piracy Examples PLANTS ANIMALS Neem, Murrah Turmeric Bitter gourd Basmati Brinjal WHAT NEXT ?????? Slide 19: Conservation of medicinal plants Protection of bio-wealth against exploitation by outsiders Strong IPR Protection Regime Priorities and Concerns Slide 20: A CASE STUDY Slide 21: Jojoba J OJOBA © A.K. Chhabra Simmondsia chinensis Jojoba (pronounced ho-ho-ba) arid regions of northern Mexico and the southwestern US 15 feet in height, with leathery, blue-green leaves The plants can live for 200 years. Slide 22: Jojoba J OJOBA © A.K. Chhabra Simmondsia chinensis Serious attention in the early 1970’s, with the enactment of the Endangered Species Act. The Sperm Whale, considered an endangered species under the parameters set up by this Act, became protected to the extent that no sperm whale oil could be imported into the US. Up until then we had been importing 55 million gallons of the oil each year. A large Sperm Whale can yield several tons of the oil and the wax. Slide 23: SPERM WHALE J OJOBA © A.K. Chhabra Synthetic substitutes are difficult to produce, so other natural sources were investigated. Slide 24: SPERM WHALE J OJOBA © A.K. Chhabra Slide 25: SPERM WHALE J OJOBA © A.K. Chhabra Slide 26: SPERM WHALE J OJOBA © A.K. Chhabra A fish known as the Orange Roughy makes a similar oil, but it has been so over fished that it could not be counted on as a long term solution. The Jojoba plant was DISCOVERED Slide 27: Field View Jojoba bushes are either male or female. Jojoba is a cross-pollinated crop and mostly depends upon wind for pollination. It has been known since 1933 that its seeds contain an oil (50% by weight) almost identical in chemical composition to sperm whale oil. Prior to the Endangered Species Act, however, it was more economical to get the oil from the Sperm Whale. Interestingly, we did look at Jojoba as a source of oil earlier. Experimental plantings were established at the Boyce Thompson Southwestern Arboretum in Superior Arizona in 1925, and Jojoba oil was used during WW II in motors and transmissions for military equipment. After the war ended, petroleum became plentiful, and Jojoba oil use declined. Jojoba is the only plant known to produce this oil, composed of fatty alcohols and fatty acids instead of glycerol and fatty acids like most oils. Slide 28: Uses candle wax, polishes, coatings for fruits and pills, insulation for batteries and wires, varnishes and paints, detergents, plastics and resins, leather softeners, transformer coolants, lotions and shampoos. cosmetics lubricants for everything from artificial hearts to watches ,, motors, and transmissions low-calorie cooking oil that does not become rancid antifoaming agents in fermentation HUNDREDS OF DOLLARS PER GALLON + Medicinal Uses Jojoba is now commercially grown in Argentina, Australia, Mexico, Israel, and India. Slide 29: HUNDREDS OF DOLLARS PER GALLON Jojoba is now commercially grown in Argentina, Australia, Mexico, Israel, and India. Slide 30: HUNDREDS OF DOLLARS PER GALLON The genes that code for the enzymes involved in Jojoba oil biosynthesis have been identified and inserted into transgenic plants. The intention is to develop Jojoba oil producing plants that can easily be grown in conventional agricultural systems. Time will tell if this will be practical. POTATO BANANA PLANT AS A FACTORY Slide 31: Plant View Fruit Slide 32: The Plant Male Plant View 2 Male flowers In the male plant flowers are born in clusters and the number of flower varies from 7 to 36 per cluster. Slide 33: The Plant Male flowers Male Plant View 5 In the male plant flowers are born in clusters and the number of flower varies from 7 to 36 per cluster. Slide 34: Female Flower in different moods...... Slide 35: Pedicel Calyx Stigma Female Plant View 3 Slide 36: The Fruit Female Plant View Fruit Slide 37: The Fruit Typically flowering occurs at alternate nodes along the branches, although some plants produce flowers at each node and others produce them at every third node. Source: Slide 40: In order to protect the medicinal plants it is necessary to: First identify them, Study their natural distribution, Assess their population status and then to take scientific measures to ensure their conservation and cultivation. Slide 41: in situ and ex situ approaches Maintaining Biological Diversity The Ministry of Environment and Forests has identified 14 sites for in situ biosphere reserves of which 8 have already been established. 85 national parks, 488 sanctuaries and reserves have been set up under the Indian Wild Life (protection) Act, 1972. Slide 42: It conserves a given species in its natural habitat In situ conservation is the ideal approach to be followed because It also carries all its associated taxa (e.g. , pollinators) as well, thus ensuring a dynamic system in which species are continuously evolving. Slide 43: However, due to various types of pressures in land use, it is unlikely that more than 4% of the world's land area can be set aside for this purpose. This is particularly true for India. Hence, in situ conservation needs to be augmented through ex situ measures (Natesh 2001). Slide 44: Herbal Garden CCSHAU Slide 45: Herbal Garden CCSHAU Slide 47: Ch. Devi Lal Herbal Nature Park Chuharpur, Yamuna Nagar Haryana The mountainous belt of Shiwaliks in Haryana has a rich diversity of medicinal plant species. Slide 48: KERALA AGRICULTURAL UNIVERSITY Slide 49: Exhaustive collection of medicinal plants Herbal Garden Keral Agricultural University Slide 50: 12 ACCESSIONS OF PALMAROSA 20 ACCESSIONS OF VETIVER Slide 51: Ex situ approaches involve removal of either whole plant or its reproductive parts for conservation in an alien environment and includes different types of garden (botanical, herbal) and banks (seed, cryo, and DNA). Slide 52: Biotechnology and Conservation Slide 53: maintenance of cultures under normal growing conditions(25oC+2oC) maintenance under conditions that limit growth e.g. use of osmoticum or growth retardants and low incubation temperature); and cryopreservation in liquid nitrogen (-196oC). Germplasm conservation through in vitro techniques can be achieved through three basic approaches: SHORT TERM STORAGE MEDIUM TERM STORAGE LONG TERM STORAGE Slide 54: Usually, seeds are best suited for storage. A number of medicinal species do not set seeds It is now possible to store material other than seeds such as pollen or clones obtained from elite genotypes, cell lines with special attributes, in vitro raised tissues /organs, genetically transformed material or even a whole library of the genes of a species. Slide 55: Cryo Preservation LONG-TERM STORAGE Slide 56: Tissue culture technology is of tremendous value for the conservation of crops that are Either sterile/devoid of seed production mechanism, shy bearers, produces recalcitrant seeds, clonally propagated perennial crops or difficult to conserve under ex situ conditions. Slide 57: Suitable protocols for rapid clonal propagation & their in vitro conservation have been developed for the medicinal plants like Rauvolfia serpentina, Tylophora indica, Coleus forskohlii, Sanssurea lappa, Pogostemon patchouli and Gentiana kuroo etc. (Chandel et al.1995). Examples Slide 58: Many of these genes have been sequenced and can be stored in the form of long strings of symbols in laboratory records, publications or in computer data base in future. Germplasm Storage in terms of Data Bank (gene sequences) Slide 59: ……AAGTCATCGGAATTCCGATCATCGATCT…….. Slide 60: (Source: Sudhir Kumar 2003) Growth of Gene Bank Sequence (millions) Base pairs of DNA (millions) Biological Data Sources : PROSITEDOC PRINTS Biological Data Sources BLOCKS PFAMB PFAMA SWISSFAM DOMO PRODOM PROSITE PDB DSSP SWISSPROT TREEMBL EMBL DBSTS DDBJ Entrez Patent USPTO PIR Patent PCT NRL3D Medline GENEPEPT TFCLASS LOCUS LINK TFMATRIX TFSITE UNIGENE TFCELL GSDB TIGR TAXONOMY Celera GENETICCODE GENBANK RHDB HUGO GDB OMIM SNP dbSNP Contact dbSNP Population SNP Consortium WIT KEGG STKE ENZYME FASTA BLAST SSEARCH Microbial Genomes Fly Base C. Elegans Clinical DB CLUSTALW EBI Patent JPO (Source: Sudhir Kumar 2003) Slide 62: National Gene Banks (NGBs) for Medicinal & Aromatic Plants DBT: The Department of Biotechnology has established a network of three national gene banks dedicated to medicinal and aromatic plants at CIMAP: The Central Institute of Medicinal and Aromatic Plants, Luknow; NBPGR: National Bureau of Plant Genetic Resources, New Delhi; and TBGRI Tropical Botanic Garden and Research Institute Triuvananthapuram. Slide 63: Each gene bank has four major components Fields bank Seed bank in vitro bank Cryo bank Slide 64: TBGRI concentrates its activity on Peninsular India, CIMAP & NBPGR cover the northern regions. COVERAGE Slide 65: Fourth gene bank has been established Regional Research Laboratory, Jammu, Western Himalayan Region. EFFORTS Department of Biotechnology, New Delhi (DBT) holding discussions with the Government of Mahal for this purpose. Slide 66: The DBT is also the overall coordinator for the projects on ex situ conservation of medicinal and aromatic plants among the G-15 countries. Under this project each Member Country is to establish national gene bank(s) which can then be networked at the regional and G-15 levels India, Indonesia, and Malaysia are in the process of bringing out a Regional Inventory of important medicinal and aromatic species. A Symposium organized at Kuala Lumpur has showcased the ongoing efforts under the aegis of the G-15 Project. Slide 67: No of patents on jojoba till today in India: 19 PATENTS Patent Site More information on patents Patent details 1 2 3 4 CLICK THE NUMBER TO KNOW MORE Slide 68: Future Options WHAT IS INSIGNIFICANT TODAY, MAY BECOME SIGNIFICANT TOMORROW. POISONOUS PLANTS MAY BE A WEALTH OF TOMORROW. Bread mould - source of one of the most useful antibiotics; Armadillos - useful in medical research because they are the only experimental animal that can be infected with leprosy; Madagascar periwinkle-a source of an antileukemic drug, Heat-loving microbe living in a hot spring at Yellowstone-Taq Pol. Slide 69: POLICY MEASURES FOR BIODIVERSITY AND IPR INITIATIVES GROUP RECOMMENDATIONS The protection on ITKs to be bestowed irrespective of time frame. The ITK- associated accessions be characterized, analyzed and evaluated on priority basis. Contd………… Slide 70: POLICY MEASURES FOR BIODIVERSITY AND IPR INITIATIVES GROUP RECOMMENDATIONS The facilities for low cost medium term storage facilities be extended to all SAUs. Contd………… Slide 71: POLICY MEASURES FOR BIODIVERSITY AND IPR INITIATIVES GROUP RECOMMENDATIONS The allocation for agricultural research be increased substantially from its current abysmal position not worth mentioning to at least 2 – 3 % in the wake of new challenges. Contd………… Slide 72: POLICY MEASURES FOR BIODIVERSITY AND IPR INITIATIVES GROUP RECOMMENDATIONS The germplasm should be maintained at least in 3 replications at more than one place by the nodal agency. Contd………… Slide 73: POLICY MEASURES FOR BIODIVERSITY AND IPR INITIATIVES GROUP RECOMMENDATIONS The germplasm maintenance should be accorded top priority. Contd………… Slide 74: POLICY MEASURES FOR BIODIVERSITY AND IPR INITIATIVES GROUP RECOMMENDATIONS Impact on socio-economic conditions of farming community should receive highest research priority. Contd………… Slide 75: INDIA : http://ipindia.gov.in WIPO : http://www.wipo.net EPO :http://ep.espacenet.com SINGAPORE : http://www.surfip.gov.sg/ USPTO : http://www.uspto.gov./ UKPO : http://www.patent.gov.uk JAPAN : http://www.jpo.go.jp WTO : http://www.wto.org IMPORTANT WEBSITES ON-IPR Slide 76: TRASH SAVE US FOR TOMORROW Slide 77: Thank You ................if you determine to save one plant only You do not have the permission to view this presentation. In order to view it, please contact the author of the presentation.
Biodiversity IPR extended chhabra61 Download Post to : URL : Related Presentations : Share Add to Flag Embed Email Send to Blogs and Networks Add to Channel Uploaded from authorPOINT lite Insert YouTube videos in PowerPont slides with aS Desktop Copy embed code: (To copy code, click on the text box) Embed: URL: Thumbnail: WordPress Embed Customize Embed The presentation is successfully added In Your Favorites. Views: 48 Category: Education License: All Rights Reserved Like it (1) Dislike it (0) Added: September 26, 2010 This Presentation is Public Favorites: 0 Presentation Description No description available. Comments Posting comment... Premium member Presentation Transcript Slide 1: BIODIVERSITY GROUP V.K. Gour, JNKVV, Jabalpur A.K. Chhabra, CCSHAU, Hisar P.K. Barua, AAU, Jorhat, Assam Hulas Pathak, IGAU, Raipur Sunil Umate, Maharashtra BIODIVERSITY CONSERVATION & IPR PERSPECTIVE: A CASE STUDY OF MEDICINAL PLANTS IPR in Relation to Agriculture and Allied Fields Slide 2: A conservative working estimate suggests that there might be around 12.5 million species on this earth. 1.7 million species have been described to date SOME FACTS GLOBAL Total number of species existing on earth at present vary from 25 million to nearly 100 million. Slide 3: Contd………… Slide 6: 49 major crop species domesticated Around 583 plant species are reported to be cultivated in India 334 species wild relatives of crop species (Arora, 1991, Paroda, et al. 1998) Slide 7: India is floristically very rich and hence counted among the of the world. One of the 12 mega centers of biodiversity megabiodiversity centers Has two of the eight hotspots (western ghat and northeast region) Slide 8: The country ranks tenth among the plant-rich nations of the world -- fourth amongst the countries of Asia FACTS INDIA Slide 9: Our Strength: The bio- richness Source: K.P. Singh (2005) FLORA Flowering plants (angiosperms) 15000-18000 Medicinal plants 1500 species Cultivated plants 160 species FAUNA Domestic Animals 450 m heads Cattles (26 breeds); Buffaloes(8 breeds); Sheep (40 breeds); Goats (20 breeds); Camels (8 br.); Horses (6 breeds); Poultry (18 Breeds) Microbes Slide 10: Demand for medicinal plant is increasing in both developing and developed countries due to rising appreciation of natural products, being non-toxic, having no side-effects, easily available and affordable, and sometime the only source of health care available to the poor Slide 11: The World Health Organization (WHO) estimated that about 80% of the population of developing countries rely on traditional medicines derived from plants, for primary health care. WHO Data from Internet Slide 12: Modern pharmaceuticals still contains at least 25% drugs derived from plants and many others which are synthetic analogue built on prototype compounds isolated from plants (Natesh 2001). Slide 13: There are estimated to be over manufacturing units in India (Natesh 2001) 7800 pharmaceuticals Slide 14: Because of: infrastructural development, growth-exploitation, environment-unfriendly harvesting techniques, loss of growth habitats and unmonitored trade of medicinal plants. Threat of extinction That’s why there is a need for conservation? Slide 15: Irreversible loss of biological diversity: extinction of species The natural or "background" rate of extinction 1-10 species a year. Slide 16: Present extinction rates have accelerated this century to at least 1,000 species per year and may climb to 10,000 times the background rate during the next century, if present trends continue. PROTECTED Extinction Slide 17: 100 Red-Listed Medicinal Plants of Conservation Concern in Southern India K. Ravi Kumar and D.K. Ved. Bangalore, Foundation for Revitalisation of Local Health Traditions (FRLHT), 2000, 467 p., tables, plates, maps. Rare, Endangered and Threatened and meet the criteria for RED LISTING. Slide 18: Threat of bio-piracy Examples PLANTS ANIMALS Neem, Murrah Turmeric Bitter gourd Basmati Brinjal WHAT NEXT ?????? Slide 19: Conservation of medicinal plants Protection of bio-wealth against exploitation by outsiders Strong IPR Protection Regime Priorities and Concerns Slide 20: A CASE STUDY Slide 21: Jojoba J OJOBA © A.K. Chhabra Simmondsia chinensis Jojoba (pronounced ho-ho-ba) arid regions of northern Mexico and the southwestern US 15 feet in height, with leathery, blue-green leaves The plants can live for 200 years. Slide 22: Jojoba J OJOBA © A.K. Chhabra Simmondsia chinensis Serious attention in the early 1970’s, with the enactment of the Endangered Species Act. The Sperm Whale, considered an endangered species under the parameters set up by this Act, became protected to the extent that no sperm whale oil could be imported into the US. Up until then we had been importing 55 million gallons of the oil each year. A large Sperm Whale can yield several tons of the oil and the wax. Slide 23: SPERM WHALE J OJOBA © A.K. Chhabra Synthetic substitutes are difficult to produce, so other natural sources were investigated. Slide 24: SPERM WHALE J OJOBA © A.K. Chhabra Slide 25: SPERM WHALE J OJOBA © A.K. Chhabra Slide 26: SPERM WHALE J OJOBA © A.K. Chhabra A fish known as the Orange Roughy makes a similar oil, but it has been so over fished that it could not be counted on as a long term solution. The Jojoba plant was DISCOVERED Slide 27: Field View Jojoba bushes are either male or female. Jojoba is a cross-pollinated crop and mostly depends upon wind for pollination. It has been known since 1933 that its seeds contain an oil (50% by weight) almost identical in chemical composition to sperm whale oil. Prior to the Endangered Species Act, however, it was more economical to get the oil from the Sperm Whale. Interestingly, we did look at Jojoba as a source of oil earlier. Experimental plantings were established at the Boyce Thompson Southwestern Arboretum in Superior Arizona in 1925, and Jojoba oil was used during WW II in motors and transmissions for military equipment. After the war ended, petroleum became plentiful, and Jojoba oil use declined. Jojoba is the only plant known to produce this oil, composed of fatty alcohols and fatty acids instead of glycerol and fatty acids like most oils. Slide 28: Uses candle wax, polishes, coatings for fruits and pills, insulation for batteries and wires, varnishes and paints, detergents, plastics and resins, leather softeners, transformer coolants, lotions and shampoos. cosmetics lubricants for everything from artificial hearts to watches ,, motors, and transmissions low-calorie cooking oil that does not become rancid antifoaming agents in fermentation HUNDREDS OF DOLLARS PER GALLON + Medicinal Uses Jojoba is now commercially grown in Argentina, Australia, Mexico, Israel, and India. Slide 29: HUNDREDS OF DOLLARS PER GALLON Jojoba is now commercially grown in Argentina, Australia, Mexico, Israel, and India. Slide 30: HUNDREDS OF DOLLARS PER GALLON The genes that code for the enzymes involved in Jojoba oil biosynthesis have been identified and inserted into transgenic plants. The intention is to develop Jojoba oil producing plants that can easily be grown in conventional agricultural systems. Time will tell if this will be practical. POTATO BANANA PLANT AS A FACTORY Slide 31: Plant View Fruit Slide 32: The Plant Male Plant View 2 Male flowers In the male plant flowers are born in clusters and the number of flower varies from 7 to 36 per cluster. Slide 33: The Plant Male flowers Male Plant View 5 In the male plant flowers are born in clusters and the number of flower varies from 7 to 36 per cluster. Slide 34: Female Flower in different moods...... Slide 35: Pedicel Calyx Stigma Female Plant View 3 Slide 36: The Fruit Female Plant View Fruit Slide 37: The Fruit Typically flowering occurs at alternate nodes along the branches, although some plants produce flowers at each node and others produce them at every third node. Source: Slide 40: In order to protect the medicinal plants it is necessary to: First identify them, Study their natural distribution, Assess their population status and then to take scientific measures to ensure their conservation and cultivation. Slide 41: in situ and ex situ approaches Maintaining Biological Diversity The Ministry of Environment and Forests has identified 14 sites for in situ biosphere reserves of which 8 have already been established. 85 national parks, 488 sanctuaries and reserves have been set up under the Indian Wild Life (protection) Act, 1972. Slide 42: It conserves a given species in its natural habitat In situ conservation is the ideal approach to be followed because It also carries all its associated taxa (e.g. , pollinators) as well, thus ensuring a dynamic system in which species are continuously evolving. Slide 43: However, due to various types of pressures in land use, it is unlikely that more than 4% of the world's land area can be set aside for this purpose. This is particularly true for India. Hence, in situ conservation needs to be augmented through ex situ measures (Natesh 2001). Slide 44: Herbal Garden CCSHAU Slide 45: Herbal Garden CCSHAU Slide 47: Ch. Devi Lal Herbal Nature Park Chuharpur, Yamuna Nagar Haryana The mountainous belt of Shiwaliks in Haryana has a rich diversity of medicinal plant species. Slide 48: KERALA AGRICULTURAL UNIVERSITY Slide 49: Exhaustive collection of medicinal plants Herbal Garden Keral Agricultural University Slide 50: 12 ACCESSIONS OF PALMAROSA 20 ACCESSIONS OF VETIVER Slide 51: Ex situ approaches involve removal of either whole plant or its reproductive parts for conservation in an alien environment and includes different types of garden (botanical, herbal) and banks (seed, cryo, and DNA). Slide 52: Biotechnology and Conservation Slide 53: maintenance of cultures under normal growing conditions(25oC+2oC) maintenance under conditions that limit growth e.g. use of osmoticum or growth retardants and low incubation temperature); and cryopreservation in liquid nitrogen (-196oC). Germplasm conservation through in vitro techniques can be achieved through three basic approaches: SHORT TERM STORAGE MEDIUM TERM STORAGE LONG TERM STORAGE Slide 54: Usually, seeds are best suited for storage. A number of medicinal species do not set seeds It is now possible to store material other than seeds such as pollen or clones obtained from elite genotypes, cell lines with special attributes, in vitro raised tissues /organs, genetically transformed material or even a whole library of the genes of a species. Slide 55: Cryo Preservation LONG-TERM STORAGE Slide 56: Tissue culture technology is of tremendous value for the conservation of crops that are Either sterile/devoid of seed production mechanism, shy bearers, produces recalcitrant seeds, clonally propagated perennial crops or difficult to conserve under ex situ conditions. Slide 57: Suitable protocols for rapid clonal propagation & their in vitro conservation have been developed for the medicinal plants like Rauvolfia serpentina, Tylophora indica, Coleus forskohlii, Sanssurea lappa, Pogostemon patchouli and Gentiana kuroo etc. (Chandel et al.1995). Examples Slide 58: Many of these genes have been sequenced and can be stored in the form of long strings of symbols in laboratory records, publications or in computer data base in future. Germplasm Storage in terms of Data Bank (gene sequences) Slide 59: ……AAGTCATCGGAATTCCGATCATCGATCT…….. Slide 60: (Source: Sudhir Kumar 2003) Growth of Gene Bank Sequence (millions) Base pairs of DNA (millions) Biological Data Sources : PROSITEDOC PRINTS Biological Data Sources BLOCKS PFAMB PFAMA SWISSFAM DOMO PRODOM PROSITE PDB DSSP SWISSPROT TREEMBL EMBL DBSTS DDBJ Entrez Patent USPTO PIR Patent PCT NRL3D Medline GENEPEPT TFCLASS LOCUS LINK TFMATRIX TFSITE UNIGENE TFCELL GSDB TIGR TAXONOMY Celera GENETICCODE GENBANK RHDB HUGO GDB OMIM SNP dbSNP Contact dbSNP Population SNP Consortium WIT KEGG STKE ENZYME FASTA BLAST SSEARCH Microbial Genomes Fly Base C. Elegans Clinical DB CLUSTALW EBI Patent JPO (Source: Sudhir Kumar 2003) Slide 62: National Gene Banks (NGBs) for Medicinal & Aromatic Plants DBT: The Department of Biotechnology has established a network of three national gene banks dedicated to medicinal and aromatic plants at CIMAP: The Central Institute of Medicinal and Aromatic Plants, Luknow; NBPGR: National Bureau of Plant Genetic Resources, New Delhi; and TBGRI Tropical Botanic Garden and Research Institute Triuvananthapuram. Slide 63: Each gene bank has four major components Fields bank Seed bank in vitro bank Cryo bank Slide 64: TBGRI concentrates its activity on Peninsular India, CIMAP & NBPGR cover the northern regions. COVERAGE Slide 65: Fourth gene bank has been established Regional Research Laboratory, Jammu, Western Himalayan Region. EFFORTS Department of Biotechnology, New Delhi (DBT) holding discussions with the Government of Mahal for this purpose. Slide 66: The DBT is also the overall coordinator for the projects on ex situ conservation of medicinal and aromatic plants among the G-15 countries. Under this project each Member Country is to establish national gene bank(s) which can then be networked at the regional and G-15 levels India, Indonesia, and Malaysia are in the process of bringing out a Regional Inventory of important medicinal and aromatic species. A Symposium organized at Kuala Lumpur has showcased the ongoing efforts under the aegis of the G-15 Project. Slide 67: No of patents on jojoba till today in India: 19 PATENTS Patent Site More information on patents Patent details 1 2 3 4 CLICK THE NUMBER TO KNOW MORE Slide 68: Future Options WHAT IS INSIGNIFICANT TODAY, MAY BECOME SIGNIFICANT TOMORROW. POISONOUS PLANTS MAY BE A WEALTH OF TOMORROW. Bread mould - source of one of the most useful antibiotics; Armadillos - useful in medical research because they are the only experimental animal that can be infected with leprosy; Madagascar periwinkle-a source of an antileukemic drug, Heat-loving microbe living in a hot spring at Yellowstone-Taq Pol. Slide 69: POLICY MEASURES FOR BIODIVERSITY AND IPR INITIATIVES GROUP RECOMMENDATIONS The protection on ITKs to be bestowed irrespective of time frame. The ITK- associated accessions be characterized, analyzed and evaluated on priority basis. Contd………… Slide 70: POLICY MEASURES FOR BIODIVERSITY AND IPR INITIATIVES GROUP RECOMMENDATIONS The facilities for low cost medium term storage facilities be extended to all SAUs. Contd………… Slide 71: POLICY MEASURES FOR BIODIVERSITY AND IPR INITIATIVES GROUP RECOMMENDATIONS The allocation for agricultural research be increased substantially from its current abysmal position not worth mentioning to at least 2 – 3 % in the wake of new challenges. Contd………… Slide 72: POLICY MEASURES FOR BIODIVERSITY AND IPR INITIATIVES GROUP RECOMMENDATIONS The germplasm should be maintained at least in 3 replications at more than one place by the nodal agency. Contd………… Slide 73: POLICY MEASURES FOR BIODIVERSITY AND IPR INITIATIVES GROUP RECOMMENDATIONS The germplasm maintenance should be accorded top priority. Contd………… Slide 74: POLICY MEASURES FOR BIODIVERSITY AND IPR INITIATIVES GROUP RECOMMENDATIONS Impact on socio-economic conditions of farming community should receive highest research priority. Contd………… Slide 75: INDIA : http://ipindia.gov.in WIPO : http://www.wipo.net EPO :http://ep.espacenet.com SINGAPORE : http://www.surfip.gov.sg/ USPTO : http://www.uspto.gov./ UKPO : http://www.patent.gov.uk JAPAN : http://www.jpo.go.jp WTO : http://www.wto.org IMPORTANT WEBSITES ON-IPR Slide 76: TRASH SAVE US FOR TOMORROW Slide 77: Thank You ................if you determine to save one plant only