fascinating facts about DNA

Slide 1: 

Examples Marker-assisted Selection Copyright of original pictures (if any) used from other sources lies with the original developer. This is being used for non commercial purpose and educational use only

Slide 2: 

Identification of AFLP and STS markers closely linked to the def locus in pea M. von Stackelberg1     , S. Lindemann2, M. Menke3, S. Riesselmann1 and H.-J. Jacobsen1 The recessive mutation of the def gene of pea (Pisum sativum L.) leads to the loss of the hilum, the abscission zone between the seed and the pod. Thereby, it reduces the free dispersal of the seeds through pod shattering. Theor Appl Genet (2003) 106: 1433-1437

Slide 3: 

Bulked Segregant Analysis followed by single plant analyses of over 200 homozygous individuals of a population of 476 F2 plants were used to detect markers closely linked to the def locus. x 'DGV' (def wild-type) 'PF' (def mutant) AFLP technique in combination with silver staining Fifteen AFLP loci showed a genetic distance less than 5 and two of them less than 1 centiMorgans (cM) to the gene of interest. AFLPs were converted into sequence tagged sites (STSs) and into a newly refined AFLP-based single locus marker named the 'sequence specified AFLP' (ssAFLP). Theor Appl Genet (2003) 106: 1433-1437

Slide 4: 

PCR-based markers linked to dominant genes for male-fertility restoration in Pampa CMS of rye (Secale cereale L.) Theor Appl Genet (2003) 106: 1184-1190 Stracke et al 2003 Cytoplasmic male sterility (CMS) Rye The introgression of these effective restorer genes (Rfp1 and Rfp2, respectively) into breeding material can be facilitated by marker-assisted selection. Iranian primitive rye population (IRAN IX) Argentinean landrace (Pico Gentario) Rfp1 Rfp2

Slide 5: 

Non-restorer Lo6 X restorer IRAN IX Non-restorer Lo6 X restorer Pico Gentario CROSSES RAPDs and AFLPs F2 Population SEVERAL AFLP MARKERS IDENTIFIED Converted in to fragment-specific sequence-characterised amplified region (SCAR) markers 2.9 cM (Rfp1) and 5.2 cM (Rfp2). MAS

Slide 6: 

Identification of SCAR markers linked to Pl-w mildew resistance in apple Theor Appl Genet (2003) 106: 1178-1183 A progeny derived from the crab apple 'White Angel' (the source of Pl-w) was screened for resistance to mildew for two seasons in the glasshouse and four seasons in the field. Susceptible Bulk Resistant Bulk 176 AFLP DNA bulks DNA bulks Screened with Seven AFLP markers were identified that differentiated the bulks Two of these markers were developed into SCARs 4.6 cM 6.4 cM

Slide 7: 

LRR Leucine Rich Repeat (LRR) regions Resistance Gene Analogs (RGA) in plants are related to the NBS-LRR class of disease resistance genes RGA NBS CLASSES Candidate gene approach Nucleotide Binding Site (NBS) contains several sequence motifs which are highly conserved among disease resistance RGAs Disease Resistance Gene Conserved region Conserved region WHEAT Can be used to isolate disease resistance genes in other crops like: RICE MAIZE SORGHUM FRUITS VEGETABLES etc. AGCTTTAAATCGATTCGGATT

Slide 8: 

a b WHEAT Disease 1 b a Disease 2 Disease 3 Disease 4 c c RICE MAIZE COTTON Crop Disease Genes And conserved regions RGAs Indicates conserved regions How to use RGAs Probe / primers

Slide 9: 

Identification of resistance gene analogs linked to two blast resistance genes in rice indica varieties Zhong 156 x Gumei RAPD markers (Zhuang et a!. 1997) 146 recombinant inbred lines (RILs), Being maintained at the Genetics Laboratory of International Rice Research Institute. Eight pairs of RGA primers were used (Table 1),