Medicinal Plants conservation our national heritage

Views:
 
Category: Entertainment
     
 

Presentation Description

No description available.

Comments

By: chhabra61 (34 month(s) ago)

Please let me know your academic details. I would be happy to send it to you.

By: MONU.KTR (34 month(s) ago)

dear sir please send me this ppt file iam very thankful for u email id is manish.cia@gmail.com

Presentation Transcript

Slide 1: 

A.K. Chhabra GROUP 1 Medicinal Plants National Heritage Protect and Safeguard them for Coming Generation

Slide 2: 

A conservative working estimate suggests that there might be around 12.5 million species on this earth. 1.7 million species have been described to date SOME FACTS GLOBAL Total number of species existing on earth at present vary from 25 million to nearly 100 million.

Slide 3: 

49 major crop species domesticated Around 583 plant species are reported to be cultivated in India 334 species wild relatives of crop species (Arora, 1991, Paroda, et al. 1998)

Slide 4: 

Jojoba J OJOBA © A.K. Chhabra Simmondsia chinensis Jojoba (pronounced ho-ho-ba) arid regions of northern Mexico and the  southwestern US 15 feet in height, with leathery, blue-green leaves The plants can live for 200 years.

Slide 5: 

Jojoba J OJOBA © A.K. Chhabra Simmondsia chinensis Serious attention in the early 1970’s, with the enactment of the Endangered Species Act. The Sperm Whale, considered an endangered species under the parameters set up by this Act, became protected to the extent that no sperm whale oil could be imported into the US.  Up until then we had been importing 55 million gallons of the oil each year. A large Sperm Whale can yield several tons of the oil and the wax.

Slide 6: 

SPERM WHALE J OJOBA © A.K. Chhabra Synthetic substitutes are difficult to produce, so other natural sources were investigated.

Slide 7: 

SPERM WHALE J OJOBA © A.K. Chhabra

Slide 8: 

SPERM WHALE J OJOBA © A.K. Chhabra

Slide 9: 

SPERM WHALE J OJOBA © A.K. Chhabra A fish known as the Orange Roughy makes a similar oil, but it has been so over fished that it could not be counted on as a long term solution. The Jojoba plant was DISCOVERED

Slide 10: 

Field View Jojoba bushes are either male or female. Jojoba is a cross-pollinated crop and mostly depends upon wind for pollination. It has been known since 1933 that its seeds contain an oil (50% by weight) almost identical in chemical composition to sperm whale oil.  Prior to the Endangered Species Act, however, it was more economical to get the oil from the Sperm Whale.  Interestingly, we did look at Jojoba as a source of oil earlier.  Experimental plantings were established at the Boyce Thompson Southwestern Arboretum in Superior Arizona in 1925, and Jojoba oil was used during WW II in motors and transmissions for military equipment.  After the war ended, petroleum became plentiful, and Jojoba oil use declined.  Jojoba is the only plant known to produce this oil, composed of fatty alcohols and fatty acids instead of glycerol and fatty acids like most oils.

Slide 11: 

Uses candle wax, polishes, coatings for fruits and pills, insulation for batteries and wires, varnishes and paints, detergents, plastics and resins, leather softeners, transformer coolants, lotions and shampoos. cosmetics lubricants for everything from artificial hearts to watches ,, motors, and transmissions low-calorie cooking oil that does not become rancid antifoaming agents in fermentation HUNDREDS OF DOLLARS PER GALLON + Medicinal Uses Jojoba is now commercially grown in Argentina, Australia, Mexico, Israel, and India.

Slide 12: 

HUNDREDS OF DOLLARS PER GALLON Jojoba is now commercially grown in Argentina, Australia, Mexico, Israel, and India.

Slide 13: 

HUNDREDS OF DOLLARS PER GALLON The genes that code for the enzymes involved in Jojoba oil biosynthesis have been identified and inserted into transgenic plants.  The intention is to develop Jojoba oil producing plants that can easily be grown in conventional agricultural systems.  Time will tell if this will be practical.

Slide 14: 

Plant View Fruit

Slide 15: 

The Plant Male Plant Male flowers In the male plant flowers are born in clusters and the number of flower varies from 7 to 36 per cluster.

Slide 16: 

The Plant Male Plant View 2 Male flowers In the male plant flowers are born in clusters and the number of flower varies from 7 to 36 per cluster.

Slide 17: 

The Plant Male flowers Male Plant View 5 In the male plant flowers are born in clusters and the number of flower varies from 7 to 36 per cluster.

Slide 18: 

The Plant Male flowers Male Plant View 6 Sepals Anthers Tendencies towards hermaphroditism are noted in a few male bushes. These produce all grades of perfect flowers from those with an undeveloped pistil to those with a complete ovary that can even yield fertile seed.

Slide 19: 

The Plant Male flowers Male Plant View 7 Sepals Anthers In the male plant flowers are born in clusters and the number of flower varies from 7 to 36 per cluster.

Slide 20: 

Female Flower in different moods......

Slide 21: 

Female Flower Female Flower The females produce the fruit & seeds & have flowers containing one ovary with three ovules. These are commonly solitary and have no petals or odours to attract insect.

Slide 22: 

Female Flower Female Flower The females produce the fruit & seeds & have flowers containing one ovary with three ovules. These are commonly solitary and have no petals or odours to attract insect.

Slide 23: 

Female Plant View 1 Female Flower The females produce the fruit & seeds & have flowers containing one ovary with three ovules. These are commonly solitary and have no petals or odours to attract insect.

Slide 24: 

Female Plant View 2 The Plant Female flowers The females produce the fruit & seeds & have flowers containing one ovary with three ovules. These are commonly solitary and have no petals or odours to attract insect.

Slide 25: 

Pedicel Calyx Stigma Female Plant View 3

Slide 26: 

Female Plant View 4

Slide 27: 

Female Flower Three partitioning of stigma

Slide 28: 

Female Plant View 5 Seed formation

Slide 29: 

Female Plant View 6

Slide 30: 

The Fruit Typically flowering occurs at alternate nodes along the branches, although some plants produce flowers at each node and others produce them at every third node. Source:

Slide 31: 

The Fruit Female Plant View Fruit

Slide 34: 

Guayule G uayule © A.K. Chhabra Rubber Yielding Plant More than 2,000 species of plants can produce rubber, but Guayule (Parthenium argentatum) is the only one other than Hevea which has had commercial success

Slide 35: 

Guayule G uayule © A.K. Chhabra …..the rubber product becomes very elastic and weather resistant. ……latex allergies

Slide 36: 

Guayule Seed Harvester 85 to 90 percent of the guayule shrub that remains after latex extraction ………the guayule fibers to contain a type of natural pesticide to termites and, in addition, to be anti-fungal.

Slide 37: 

Isabgol (Plantago ovata)

Slide 38: 

P. ovata is an annual herb, a small stem-less plant covered with dense or soft hairy growth. Plant attains a height of 30-45cm. Crop View

Slide 39: 

Leaves are filiform or narrowly linear, 10-20cm long, entire or distantly toothed, attenuated at the base, usually 3-nerved. It has a large number of flowering, shoots arising from the main stem and appearing whorled owing to short terese stem. The Plant

Slide 40: 

Inflorescence of P. ovata is a spike made up of many florets. The flowers are sessile, small, bisexual and crowded on the main axis Inflorescence Flowers open in basipetal succession.

Slide 41: 

ISABGOL Floral Biology © A.K. Chhabra Bee Pollination

Slide 42: 

Leaves are filiform or narrowly linear, 10-20cm long, entire or distantly toothed, attenuated at the base, usually 3-nerved. It has a large number of flowering, shoots arising from the main stem and appearing whorled owing to short terese stem. The Plant

Slide 43: 

© A.K. Chhabra Tulsi Ocimum spp

Slide 44: 

Medicinal & Aromatic Plants © A.K. Chhabra Tulsi Ocimum spp. The Inflorescence Florets

Slide 45: 

Medicinal & Aromatic Plants © A.K. Chhabra The Inflorescence Florets Tulsi Ocimum spp.

Slide 46: 

Medicinal & Aromatic Plants © A.K. Chhabra The Inflorescence Spiny tips of calyx Stamen Anther Calyx Corolla Tulsi Ocimum spp.

Slide 47: 

Medicinal & Aromatic Plants © A.K. Chhabra Another view of the flower Calyx Anther Stamen Stigma Corolla Tulsi Ocimum spp.

Slide 48: 

Medicinal & Aromatic Plants © A.K. Chhabra Another view of the flower Spiny sepals Anther Bifid stigma Stamen Corolla Calyx Tulsi Ocimum spp.

Slide 49: 

World's largest flower opens

Slide 52: 

'rotting-fish' scent The Titan Arum, or "corpse flower," is the world's largest flower, with blooms that can have a diameter of well over a metre. The Titan Arum grows from a large tuber that can weigh over 80 kg (170 pounds); the flowering stalk can reach 3 metres in height, and open to a diameter of over a metre.

Slide 54: 

Biggest flower in the world Rafflesia priceii

Slide 55: 

DIVERSITY IN MAJOR INTRODUCED PLANTS MEDICINAL PLANTS Glycyrrhiza glabra, Artemisia annua, Catharanthus roseus, Aloe vera, Cassia angustifolia, Dioscorea floribunda, Duboisia myoporoides, Hyocyamus muticus and Papaver somniferum AROMATIC PLANTS Mentha arvensis, Mentha citrata, Mentha gracilis, Matricharia recutita, Lavandula officinalis and Lavandula intermedia, Pelargonium graveolens

Slide 56: 

In order to protect the medicinal plants it is necessary to: First identify them, Study their natural distribution, Assess their population status and then to take scientific measures to ensure their conservation and cultivation.

Slide 57: 

100 Red-Listed Medicinal Plants of Conservation Concern in Southern India K. Ravi Kumar and D.K. Ved. Bangalore, Foundation for Revitalisation of Local Health Traditions (FRLHT), 2000, 467 p., tables, plates, maps. Rare, Endangered and Threatened and meet the criteria for RED LISTING.

Slide 59: 

Ch. Devi Lal Herbal Nature Park Chuharpur, Yamuna Nagar Haryana The mountainous belt of Shiwaliks in Haryana has a rich diversity of medicinal plant species.

Slide 60: 

Till now 1.4 million living species have been identified of which about 750000 are insects, 41000 are vertebrates & 250000 are plants. A vast majority of species are unknown and undocumented. Over 7000 species of plants are considered to be used by 4635 ethnic communities in the country. One third of these species are trees and an equal number are herbs including grasses. The remaining one third comprises of shrubs and climbers.

Slide 61: 

Living species identified 1.4 million 750000 insects 41000 vertebrates 250000 are plants. Over 7000 species of plants are considered to be used by 4635 ethnic communities in the country. Trees Herbs Including Grasses Shrubs And Climbers 1/3 1/3 1/3

Slide 62: 

enhance the economy of the farmer & state, but also improve the quality of depleted soil & natural resources. help change in the cultivation practices which will improve the overall fresh water availability, reduce pesticide contamination and restore nutrient cycling. effect over all rehabilitation of degraded ecosystem. The cultivation of medicinal plants will

Major Centre of Medicinal Biodiversity : 

Major Centre of Medicinal Biodiversity Primary Centre of Diversity Sarpagandha, Saussurea, mango, jackfruit, jamun, black pepper, large cardamom and many cucurbits Secondary Centre of Diversity Aloe, Papaver

Slide 64: 

Demand for medicinal plant is increasing in both developing and developed countries due to rising appreciation of natural products, being non-toxic, having no side-effects, easily available and affordable, and sometime the only source of health care available to the poor

Slide 65: 

The World Health Organization (WHO) estimated that about 80% of the population of developing countries rely on traditional medicines derived from plants, for primary health care. WHO Data from Internet

Slide 66: 

Modern pharmaceuticals still contains at least 25% drugs derived from plants and many others which are synthetic analogue built on prototype compounds isolated from plants (Natesh 2001).

Slide 67: 

There are estimated to be over manufacturing units in India (Natesh 2001) 7800 pharmaceuticals

Slide 68: 

India is floristically very rich and hence counted among the of the world. One of the 12 mega centers of biodiversity megabiodiversity centers Has two of the eight hotspots (western ghat and northeast region)

Slide 69: 

There are at least 47,000 species of plants Over 8000 species of plants being used by the people of India The country ranks tenth among the plant-rich nations of the world -- fourth amongst the countries of Asia FACTS INDIA

Slide 70: 

Because of: infrastructural development, growth-exploitation, environment-unfriendly harvesting techniques, loss of growth habitats and unmonitored trade of medicinal plants. Threat of extinction That’s why there is a need for conservation?

Slide 71: 

Irreversible loss of biological diversity: extinction of species The natural or "background" rate of extinction 1-10 species a year.

Slide 72: 

Present extinction rates have accelerated this century to at least 1,000 species per year and may climb to 10,000 times the background rate during the next century, if present trends continue. PROTECTED Extinction

Slide 73: 

Threat of bio-piracy Examples Neem, Turmeric and Bitter gourd (Natesh 2001)

Slide 74: 

Conservation of medicinal plants Protection of bio-wealth against exploitation by outsiders Priorities

Slide 75: 

Herbal Garden CCSHAU

Slide 76: 

Herbal Garden CCSHAU

Slide 77: 

Herbal Garden CCSHAU

Slide 78: 

KERALA AGRICULTURAL UNIVERSITY

Slide 79: 

Exhaustive collection of medicinal plants Herbal Garden Keral Agricultural University

Slide 80: 

Largest germplasm of lemongrass in the world

Slide 81: 

12 ACCESSIONS OF PALMAROSA 20 ACCESSIONS OF VETIVER

Slide 82: 

in situ and ex situ approaches Maintaining Biological Diversity The Ministry of Environment and Forests has identified 14 sites for in situ biosphere reserves of which 8 have already been established. 85 national parks, 488 sanctuaries and reserves have been set up under the Indian Wild Life (protection) Act, 1972.

Slide 83: 

It conserves a given species in its natural habitat In situ conservation is the ideal approach to be followed because It also carries all its associated taxa (e.g. , pollinators) as well, thus ensuring a dynamic system in which species are continuously evolving.

Slide 84: 

However, due to various types of pressures in land use, it is unlikely that more than 4% of the world's land area can be set aside for this purpose. This is particularly true for India. Hence, in situ conservation needs to be augmented through ex situ measures (Natesh 2001).

Slide 85: 

Ex situ approaches involve removal of either whole plants or their reproductive parts for conservation in an alien environment and includes different types of garden (botanical, herbal) and banks (seed, cryo, and DNA).

Slide 86: 

Biotechnology and Conservation Analysis and characterization is fundamental to any conservation strategy, whether in situ or ex situ Mendelian analysis of morphological variants, biometrical approaches or protein and isozymes profiles.

Slide 87: 

maintenance of cultures under normal growing conditions(25oC+2oC) maintenance under conditions that limit growth e.g. use of osmoticum or growth retardants and low incubation temperature); and cryopreservation in liquid nitrogen (-196oC). Germplasm conservation through in vitro techniques can be achieved through three basic approaches: SHORT TERM STORAGE MEDIUM TERM STORAGE LONG TERM STORAGE

Slide 88: 

Usually, seeds are best suited for storage. A number of medicinal species do not set seeds It is now possible to store material other than seeds such as pollen or clones obtained from elite genotypes, cell lines with special attributes, in vitro raised tissues /organs, genetically transformed material or even a whole library of the genes of a species.

Slide 89: 

Medium term preservation of in vitro tissue is brought about by altering the growth rate through modification of the medium (addition of osmotic-or growth retarding agents), induction of cultures at low temperatures or a combination of the above.

Slide 90: 

Cryo Preservation LONG-TERM STORAGE

Slide 91: 

For long-term preservation cryogenic storage is the method of choice. The material is preserved under vapour pressure of liquid nitrogen (-196 oC). In all these cases it is essential to ensure the maintenance of genetic integrity under storage though the chance of genetic change occurring under cryogenic conditions are minimal. Monitoring of genetic variability is possible through enzyme- or DNA- based diagnostic methods (Natesh 2001).

Slide 92: 

Tissue culture technology is of tremendous value for the conservation of crops that are Either sterile/devoid of seed production mechanism, shy bearers, produces recalcitrant seeds, clonally propagated perennial crops or difficult to conserve under ex situ conditions.

Slide 93: 

Suitable protocols for rapid clonal propagation & their in vitro conservation have been developed for the medicinal plants like Rauvolfia serpentina, Tylophora indica, Coleus forskohlii, Sanssurea lappa, Pogostemon patchouli and Gentiana kuroo etc. (Chandel et al.1995). Examples

Slide 94: 

Cryo-preservation Suspension Cultures Protocols are being developed for...

Slide 95: 

Rapid advancement in recombinant DNA technology and molecular biology over the last two decades led to the successful isolation and cloning of probably more than 250 different plant and microbial genes that are stored as disassembled parts in the form of DNA-ethanol precipitate in laboratory freezers. Storage of Cloned Genes

Slide 96: 

Many of these genes have been sequenced and can be stored in the form of long strings of symbols in laboratory records, publications or in computer data base in future. Germplasm Storage in terms of Data Bank (gene sequences)

Slide 97: 

……AAGTCATCGGAATTCCGATCATCGATCT……..

Slide 98: 

Biological databases are being produced at a phenomenal rate As a result computers are becoming indispensable for biological research So the tasks are: 1- organize data 2- develop tools for data management 3- use tools to apply data-info to biology (Source: Sudhir Kumar 2003)

Slide 99: 

(Source: Sudhir Kumar 2003) Growth of Gene Bank Sequence (millions) Base pairs of DNA (millions)

Slide 100: 

(Source: Sudhir Kumar 2003) Rate of growth

Biological Data Sources : 

PROSITEDOC PRINTS Biological Data Sources BLOCKS PFAMB PFAMA SWISSFAM DOMO PRODOM PROSITE PDB DSSP SWISSPROT TREEMBL EMBL DBSTS DDBJ Entrez Patent USPTO PIR Patent PCT NRL3D Medline GENEPEPT TFCLASS LOCUS LINK TFMATRIX TFSITE UNIGENE TFCELL GSDB TIGR TAXONOMY Celera GENETICCODE GENBANK RHDB HUGO GDB OMIM SNP dbSNP Contact dbSNP Population SNP Consortium WIT KEGG STKE ENZYME FASTA BLAST SSEARCH Microbial Genomes Fly Base C. Elegans Clinical DB CLUSTALW EBI Patent JPO (Source: Sudhir Kumar 2003)

Slide 102: 

National Gene Banks (NGBs) for Medicinal & Aromatic Plants DBT: The Department of Biotechnology has established a network of three national gene banks dedicated to medicinal and aromatic plants at CIMAP: The Central Institute of Medicinal and Aromatic Plants, Luknow; NBPGR: National Bureau of Plant Genetic Resources, New Delhi; and TBGRI Tropical Botanic Garden and Research Institute Triuvananthapuram.

Slide 103: 

Each gene bank has four major components Fields bank Seed bank in vitro bank Cryo bank

Slide 104: 

endangered /threatened /rare species of proven medicinal value; those extensively used in traditional systems of medicine, taxa which are difficult to propagate; species which are commercially important. Objective of the NGBs is to conserve species of medicinal and aromatic plants of the following categories:

Slide 105: 

TBGRI concentrates its activity on Peninsular India, CIMAP & NBPGR cover the northern regions. COVERAGE

Slide 106: 

Fourth gene bank has been established Regional Research Laboratory, Jammu, Western Himalayan Region. EFFORTS Department of Biotechnology, New Delhi (DBT) holding discussions with the Government of Mahal for this purpose.

Slide 107: 

The DBT is also the overall coordinator for the projects on ex situ conservation of medicinal and aromatic plants among the G-15 countries. Under this project each Member Country is to establish national gene bank(s) which can then be networked at the regional and G-15 levels India, Indonesia, and Malaysia are in the process of bringing out a Regional Inventory of important medicinal and aromatic species. A Symposium organized at Kuala Lumpur has showcased the ongoing efforts under the aegis of the G-15 Project.

Slide 108: 

Future Options WHAT IS INSIGNIFICANT TODAY, MAY BECOME SIGNIFICANT TOMORROW. POISONOUS PLANTS MAY BE A WEALTH OF TOMORROW. Bread mold - source of one of the most useful antibiotics; Armadillos - useful in medical research because they are the only experimental animal that can be infected with leprosy; Madagascar periwinkle-a source of an antileukemic drug, Heat-loving microbe living in a hot spring at Yellowstone-Taq Pol.

Slide 109: 

TRASH SAVE US FOR TOMORROW

Slide 110: 

Thank You