Molecular Markers for Entomology

Views:
 
Category: Education
     
 

Presentation Description

DNA, Marker, molecular marker, entomology, forensic entomology

Comments

Presentation Transcript

Slide1:

Molecular Markers: Basic Concepts and their Utilization in Entomology A.K. Chhabra

Molecular marker systems in insects:

Molecular marker systems in insects Insects comprise the largest species composition in the entire animal kingdom and possess a vast undiscovered genetic diversity and gene pool that can be better explored using molecular marker techniques. 

Molecular marker systems in insects:

Current trends of application of DNA marker techniques in diverse domains of insect ecological studies show that mitochondrial DNA (mtDNA), microsatellites, random amplified polymorphic DNA (RAPD), expressed sequence tags (EST) and amplified fragment length polymorphism (AFLP) markers have contributed significantl y for progresses towards understanding genetic basis of insect diversity and for mapping medically and agriculturally important genes and quantitative trait loci in insect pests. Molecular marker systems in insects

Insecticidal Residues:

Insecticidal Residues Mutations, Cancer, Many New Diseases

Insecticidal Residue Effect on Food:

Insecticidal Residue Effect on Food ALTERNATIVES: Plant Derived Insecticides Herbicidal Resistance BIOLOGICAL CONTROL

Control without pesticides:

Control without pesticides

Slide7:

Biological Control Biological Control of Hemlock Woolly Adelgid Cotton fields in the western U.S. harbor a large diversity of arthropod predators and parasitoids that have the potential to contribute significantly to pest population suppression.

Slide8:

Biological control of soybean aphids A natural enemy at work: the multicolored Asian lady beetle eating a winged soybean aphid

Slide9:

What is a marker? Why these are required? Available markers?

Slide10:

Marker: A marker can be anything that guides/helps you to achieve a target. For example, a tree or a building can act as a marker if it gives you directions to reach your destination while on road. Phenotypic markers are those markers, the presence of which may indicate the presence or absence of any other linked / co-inherited trait. For Example, the presence of hair or the presence of bristles in pearl millet make the crop insect and bird resistant respectively. DNA markers are the fragments of DNA that co-segregate with any trait, but not necessarily code for those genes. These are alleles of loci at which there is sequence variation - or polymorphism - in DNA that is neutral in terms of phenotype. Markers

Slide11:

Going to Delhi for the first time by your own car Remember the way by some landmarks: Tree, Building, milestone etc. These landmarks are the markers to reach your destination Delhi Similarly markers are the landmarks to achieve your target trait, e.g. Disease Resistance What is a marker?

Slide12:

Palmistry MARKERS ………………. DESTINY AGE HEALTH MONEY JOB etc.

Slide14:

Phenotypic Markers

Slide15:

Phenotypic Markers

Slide16:

Phenotypic Markers

Slide17:

Isozyme Markers Isoenzymes allozymes EST ADH SKDK SOD LDH ME POX Etc. SOURCE STAGE LOCATION YEAR MACRO ENVT. MICRO ENVT. PLANT PART/ TISSUE Quantitative Qualitative Electrophoretic separation © A.K. Chhabra

Slide18:

Substrate Product EST V1 V2 V3 V4 Phenotype 1 V1 Yellow V2 Red V3 Green V4 Pink © A.K. Chhabra

Slide19:

Substrate Product EST V1 V2 V3 V4 V1 Yellow V2 Red V3 Green V4 Pink © A.K. Chhabra Phenotype 2

Slide20:

Substrate Product EST V1 V2 V3 V4 V1 Yellow V2 Red V3 Green V4 Pink © A.K. Chhabra Phenotype 3

Slide21:

Substrate Product EST V1 V2 V3 V4 V1 Yellow V2 Red V3 Green V4 Pink © A.K. Chhabra Phenotype 4

Slide22:

DNA Markers AFLP Amplified Fragment Length Polymorphism ALP Amplicon Length Polymorphism AP-PCR Arbitrary Primed PCR AS-PCR Allele-specific PCR CAPS Cleaved Amplified Polymorphic Sequences DAF DNA Amplification Fingerprinting RAPD Random Amplified Polymorphic DNA RFLP Restriction Fragment Length Polymorphism SCAR Sequence Characterized Amplified Regions SSCP Single Strand Cofirmational Polymorphism SSR Simple Sequence Repeats SSLP Microsaterllite Simple Sequence Length Polymorphism Minisatellite Simple Sequence Length Polymorphism STS Sequence Tagged Sites SNP Single Nucleotide Polymorphism A Brief Discussion and Uses of DNA Markers……. © A.K. Chhabra

Slide23:

© A.K. Chhabra How DNA/Gene produces phenotypes Transcription Translation Protein Synthesis

Antisense RNA Approach:

Antisense RNA Approach T G C T T A G C T G G G A C G A A T C G A C C C U G C U U A G C U G G G U G C U U A G C U G G G A A U Leu Cys Gly C C C Ala Leu Cys U G C U U A G C U G G G C G A A T C G A C A C G Cys A A U Leu Antisense oligonucleotide mRNA Growing protein Amino acid Transfer RNA Ribosome mRNA mRNA DNA 1 2 3a 3b

Slide25:

Classification of DNA Markers

Slide26:

Marker Technique Gel-based Non Gel-based PCR-based Non PCR-based Require Sequencing Information Does not Require Sequencing Information Co-dominant Dominant Detect single locus Detect multiple loci Expensive Less Expensive Reproducible Non- reproducible

Slide27:

These markers may pinpoint genes, (for example cDNA , RFLP or EST markers), or proteins, ( isozyme markers), or they may mark genomic DNA (for example genomic RFLP, RAPD or microsatellite markers).

Slide28:

DNA-Based Molecular Markers Hybridization-based PCR-based PCR followed by Hyb . Sequencing and DNA Chip-based RFLPs drDNA Single primer Paired primer APPCR RAPD DAF Inter Repeat Sequences MAAP STSs = SCARs SSRs ESTs RAMP REMAP AFLP SSCP Oligonucleotide fingerprinting using RAPD/MP-PCR fragments SNPs Gel Based Non-gel Based RFLP-based AFLP-based SSCP-based Taqman Assay Use of molecular becon OLA DNA Chip / Microarray Dynamic allele-specific hybridization Mini sequencing Pyrosequencing for SNP genotyping Temperature modulated heteroduplex analysis (TMHA) using Dhplc wave SYSTEM

Slide29:

Markers Target loci (gene dr ) Closest markers RAPD RFLP AFLP EST SSR ISSR SNP CAP a b c d e f g h i j k l m n o p q s t u v w x y z 1.3 cM 110 cM Figure 1. This line diagram shows an arbitrary genetic linkage map for a target gene (say disease resistance). The black bar structure represents a particular chromosome (linkage group) of the species under study. Lines marked “a” to “z” are markers mapped flanking to disease resistance gene (dr), “k” being closest to dr gene. “k” might be a RAPD marker, or an AFLP or RFLP or EST …. or any other marker. This shows co-segregation with the dr gene, can be used as a reliable marker for disease resistance. Linkage Map Linkage maps are prepared using MapMaker or any other related software. These maps show distribution of markers based on the recombination frequencies between the marker and the target gene and is measured in cM. On the genetic maps , the majority of the points consist of anonymous molecular markers and not genes of known function

Slide30:

Markers Target loci (gene dr ) Closest markers RAPD RFLP AFLP EST SSR ISSR SNP CAP a b c d e f g h i j k l m n o p q s t u v w x y z 1.3 cM 110 cM Figure 1. This line diagram shows an arbitrary genetic linkage map for a target gene (say disease resistance). The black bar structure represents a particular chromosome (linkage group) of the species under study. Lines marked “a” to “z” are markers mapped flanking to disease resistance gene (dr), “k” being closest to dr gene. “k” might be a RAPD marker, or an AFLP or RFLP or EST …. or any other marker. This shows co-segregation with the dr gene, can be used as a reliable marker for disease resistance. 100% 80% Linkage Drag Understanding Linkage Map

Slide31:

…….AGCTAATCTAGAGAGAGAGAGAGCTAGCTGATTCAACTAC……. …….TCGATTAGATCTCTCTCTCTCTCGATCGACTATGTTGATG……. New strand CTCGATCGAC New strand RAPD Genotype 1 Genotype 2 Genotype 3 Genotype 4 G1 G2 G3 G4 No cloning required No sequencing required Random primer of about 10 bp Detects several loci simultaneously Dominant marker Useful for phylogenetic studies Short primers are easily affected by annealing conditions thus are not reproducible Not useful for comparative mapping CTCGATCGAC

Slide32:

RAPD In this technique ………………… a single species of primer (10-base, at least 60%GC content) binds to the genomic DNA at two different sites on opposite strands of the DNA template. If these priming sites are within an amplifiable distance (2000 to 5000 bp) of each other, a discrete DNA product is produced through thermocyclic ( PCR ) amplification. The amplification yields many DNA fragments ranging in size from less than 100 bp to greater than 2 kb. These fragments are anonymous in the sense that their genomic origins are not known. Differences in the fragment patterns amplified from each genomic DNA sample are generally attributed to mutation at primer binding sites preventing the annealing of a primer. © A.K. Chhabra

Slide33:

RAPD markers have been extensively used in entomological investigations which nclude molecular fingerprinting (Fakrudin & Patil 2005), phylogenetic analysis (Zhou et al. 2000, Fakrudin et al. 2004), genetic diversity studies of agricultural insect pests such as Helicoverpa armigera (Hübner) (Zhou et al. 2000, Fakrudin et al. 2004), taxonomy and population genetics of aphids, moths and parasitoid detection (Black et al. 1992, Puterka et al. 1993, Stevens & Wall 1995, Garner & Slavicek 1996, Vaughn & Antolin 1998), social behavior in honey bees (Hunt &Page 1992), tracing the phenotypic variation in aphids (Lushai et al. 1997), maternal contribution (Hooper & Siva-Jothy 1996) and genetic linkage map construction in Tribolium castaneum (Herbst) (Beeman & Brown 1999), Apis mellifera (Linnaeus) (Hunt et al. 1995), bumble Bee Bombus terrestris (Linnaeus), and Heliothis virescens (Heckel et al.1998). RAPD marker based molecular maps have been used along with the other available maps in Bombyx mori (Hwang et al. 1998, Promboon et al.1995). Examples in entomology

Slide34:

RFLP markers arise as a result of Mutations: substitution of a single nucleotide rearrangements in the DNA intervening between two restriction sites…….. Such rearrangements might include deletion insertion and/or transposition or error in DNA replication . © A.K. Chhabra

Slide35:

Original Mutated How Substitution leads to RFLP………………… AGCTTA TTCGGATTC AAGGATCC TTCGGATTC AACTA ORIGINAL SEQ AGCTTA TTCGG ATTC AAGGATCC TTCGG ATTC AACTA RESTRICTION FRAGMENTS AGCTTA TTCGGATTC AAGGATCC TTCGGATTC AACTA MUTATED G to T AGCTTA TTCG T ATTC AAGGATCC TTCGG ATTC AACTA RESTRICTION FRAGMENTS AGCTTA TTCGG T TTC AAGGATCC TTCGGATTC AACTA Results into Restriction Fragment Length POLYMOPRPHISM deletion insertion and/or transposition or error in DNA replication ACT IN THE SAME WAY © A.K. Chhabra

Slide36:

RFLPs have been widely used in entomological research: genetic linkage maps in Heliothis (Lu et al. 1992, Heckel et al. 1998), apple maggot fly Rhagoletis pomonella (Walsh) (Roethele et al. 1997), Bombyx mori (Linnaeus) (Shi et al. 1995, Tan et al. 2001), diamond back moth Plutella xylostella (Linnaeus) (Heckel et al. 1999), Colorado beetle Leptinotarsa decemlineata (Say) (Hawthorne 2001), Colias butterflies (Wang & Porter 2004), population genetics studies (Lu et al. 1992, Haymer et al. 1992, Hall 1990), determination ofmale and female sexes in honey bee (Hall 1990), phylogenetic studies in mites and ticks (reviewed in Cruickshank 2002) and gene flow studies (reviewed in Black et al. 2001). EXAMPLES IN ENTOMOLOGY

Slide37:

Sponge Dry Tissue Papers Weight Southern Blotting (Southern, 1975) Gel DNA Nitrocellulose membrane

Slide38:

Probing / Hybridization

Slide39:

001100011100010101000101 ++-++---+++++--++++++++-+- Autoradiography and Gel Scoring Feeding Data in Computer Similarity Index V2 V1 V3 V4 V5 V6

Slide40:

BamHI-coxI 81Am mtDNA RFLP Cytoplasmic male sterility sources in pearl millet Haplotype Concept 1 Calculations

Slide41:

drDNA Dispersed repetitive DNA for fingerprinting c/a Oligonucleotide in-gel hybridization OR Oligonucleotide in-gel Fingerprinting Same as RFLP EXCEPT S-Blotting step is excluded (gels are dried and used directly for hyb.) Probe used is a REPETITIVE DNA SEQUENCE (SSR, VNTRs, STRs etc.) ADVANTAGE : Repeat sequences used are multilocus probes thus reveal polymorphism at many loci simultaneously DISADVANTAGE : Sometimes gives less no. of bands eg. In wheat and tomato. 2-15bp length

Slide42:

…….AGCTAATCTAGAGAGAGAGAGAGCTAGCTGATTCAACTAC……. …….TCGATTAGATCTCTCTCTCTCTCGATCGACTATGTTGATG……. New strand New strand AFLP GATTAGATCTCTCTC Long Fixed Primer (about 15 bp) CTA Short Random Primer (2-4 bp) G1 G2 G3 G4 No cloning required No sequencing required Long Fixed Preimer + a small random primer is used Detects several loci simultaneously > RAPD > RFLP Dominant marker Useful for fingerprinting and phylogenetic studies Long primer has a fixed position, so is reproducible Not useful for comparative mapping Requires more facilities and skill

Slide43:

Mapping of Rf1 gene in sorghum AFLP Combination of RFLP and RAPD analysis AFLP combines the specificity of restriction analysis with PCR amplification The sequence variation detected is the same as that detected by RFLP analysis, but the number of polymorphisms detected per analysis is higher AFLP uses restriction enzyme-digested genomic DNA as the template for a PCR reaction with primers that contain the restriction enzyme recognition site as well as additional ‘arbitrary’ nucleotides that extend beyond the restriction site. By varying the number of these additional ‘arbitrary’ nucleotides that extend beyond the restriction sites into the unknown sequence, it is possible to control the proportion of the ligated fragments that could be amplified. The amplified products are then resolved by polyacrylamide gel electrophoresis. In general, 75 to 150 fragments are amplified with each primer combination, and as each fragment represents a unique site, the proportion of the genome assayed with each primer combination is much higher than with any other DNA analysis approach. 15-20 minutes © A.K. Chhabra

Slide44:

Sterile Fertile Bulk Sterile Bulk Fertile LICOR GEL Desired Total No. of bands = 130-150 © A.K. Chhabra

Slide45:

F S S F 1 S F F S © A.K. Chhabra A portion of LICOR gel showing co-segregating AFLP band for Rf1 gene

Applications in Entomology:

Applications in Entomology Genetic diversity (Blears et al. 1998), insect systematics in mosquitos ( Vos et al. 1995), genetic linkage map construction in mosquito (Severson et al. 1993), Rhagoletis pomonella ( Roethele et al. 1997), Heliothis virescens ( Fabricius ) and Helicoverpa armigera ( Heckel et al. 1998), Plutella xylostella ( Heckel et al. 1999), Colarado potato beetle (Hawthorne 2001) and economically important insects, such as the silk worm(Shi et al. 1995), are examples where AFLP has been used.

Slide47:

V1 V3 V2 V4 …….AGCTAATCTAGAGAGAGAGAGAGCTAGCTGATTCAACTAC……. SSR …….TCGATTAGATCT CTCTCTCTCT CGATCGACTATGTTGATG……. (GA) 5 (CT) 5 GATTAGATCT GCTAGCT Var. 1 (GA 5 ) Var. 2 (GA 3 ) Var. 3 (GA 4 ) Var. 4 (GA 2 ) V1 V2 V3 V4

Slide48:

Sequencing required Detects FIXED LOCUS Co-dominant marker Useful for mapping studies Highly reproducible Not useful for comparative mapping Requires more facilities for Primer Synthesizing Highly polymorphic than RFLP, RAPD and AFLP More uniformly distributed in the genome Examples: 37 alleles in barley (Saghai-Maroof et al 1997) 26 alleles in soybeans (Rongwen et al. 1995) V1 V3 V2 V4 …….AGCTAATCTAGAGAGAGAGAGAGCTAGCTGATTCAACTAC……. SSR …….TCGATTAGATCT CTCTCTCTCT CGATCGACTATGTTGATG……. (GA) 5 (CT) 5 GATTAGATCT GCTAGCT V1 V2 V3 V4

Slide49:

SSRs are multiallelic (GA)20 (GA)18 (GA)15 (GA)12 (GA)4 (GA)2 P1 P2 P3 P4 P5 P6 P7 P8 P9 P10 P11 P12 © A.K. Chhabra

Multiplexing of SSRs:

Multiplexing of SSRs M M 1 2 3 4 5 6 7 8 9 10 11 12 13 Poly Poly Poly Poly Poly Poly Poly Poly Poly Mono Mono Mono Polymorphic: 9 Monomorphic: 3 Primer pairs © A.K. Chhabra Did not work

Slide51:

Multiplexing of SSRs Poly Poly Poly Poly Poly Poly Poly Poly Poly Mono Mono Mono Polymorphic: 9 Monomorphic: 3 © A.K. Chhabra Primer pairs M M 1 2 3 4 5 6 7 8 9 10 11 12 13

Slide52:

The primary application of SSRs has been in genetic diversity and genetic linkage map construction. SSR markers have been successfully used in paternity studies of Hymenoptera (Estoup et al. 1995) and genetic sexing of lepidopteron insects (Ananthakrishnan 2005). In aphids, hymenopteran insects, mosquitoes, moths and butterflies thesemarkers have provided useful information on genetics of populations (Black et al. 2001). SSRs have also been used in social wasps (Strassmann et al. 1997, silk worm (Reddy et al. 1999), Drosophila melanogaster (Hackel 2003), Hymenoptera (Estoup et al. 1994), andmoths and butterflies (Palo et al. 1995). Lehmann et al. (1997) used these markers in mosquitoes for genetic studies at population level . APPLICATIONS IN ENTOMOLOGY

Slide53:

EST © A.K. Chhabra …….UAGAUCUCUCUCUCUCUUCUCU……. m RNA …….ATCTAGAGAGAGAGAGAAGAGA……. c DNA 18-20 BP PRIMERS Provides Sequence Tag for a particular gene Sequencing required Detects FIXED LOCUS Useful for mapping studies Highly reproducible Requires more facilities for Primer Synthesizing

Slide54:

LRR Leucine Rich Repeat (LRR) regions Resistance Gene Analogs (RGA) in plants are related to the NBS-LRR class of disease resistance genes RGA NBS CLASSES Candidate gene approach Nucleotide Binding Site (NBS) contains several sequence motifs which are highly conserved among disease resistance RGAs Disease Resistance Gene Conserved region Conserved region WHEAT Can be used to isolate disease resistance genes in other crops like: RICE MAIZE SORGHUM FRUITS VEGETABLES etc. A GCT TTAAATCGAT TCG GATT

Slide55:

a b WHEAT Disease 1 b a Disease 2 Disease 3 Disease 4 c c RICE MAIZE COTTON Crop Disease Genes And conserved regions RGAs Indicates conserved regions How to use RGAs Probe / primers

Slide56:

24 Nucleotide primer …….AGCTAATCTAGAGAGAGAGAGAGCTAGCTGATTCAACTAC……. …….TCGATTAGATCTCTCTCTCTCTCGATCGACTATGTTGATG……. New strand CTCGATCGAC New strand SCAR G1 G2 G3 G4 (Sequence Characterized Amplified Region) RAPD AGCTTTTAGGCTCCATCGGATCAGTA End of RAPD Marker G1 G2 G3 G4 = STAR (Sequence Tagged Amplified Region) RAPD/AP-PCR DAF AFLP/SAMPL Product Many are codominant and their poymorphism can be increased if PCR product is digested with Restriction Enzymes. A Single fragment is Amplified with high reproducibility

Slide57:

ATCTATC AACGAGC AACGAGC ATCTATC ATCTATC + - ATCTATC SSCPs Single Stranded Conformation Polymorphism Asymmetric PCR Less Concentration More Concentration Target Gene ds DNA ds DNA with different sequence Will Yield ss DNA. DNAs of same length with different nucleotide sequence would also show polymorphism due to formation of secondary and tertiary structures. This is otherwise not possible using dsDNA It can be used with short DNA fragments Only . Can detect variation between the fragments of equal molecular weights. 0.8% 0.8% 0.8% 0.8% 0.8% 0.6%

Slide58:

SNP ? -----AGCT T TAGTC---------- -----TCGAAATCAG---------- -------AGCT G TAGTC---------- -------TCGAAATCAG---------- -------AGCT G TAGTC---------- -------TCGA C ATCAG---------- -------AGCTATAGTC---------- -------TCGATATCAG---------- NEW SAME DNA Replication SNPs are Biallelic © A.K. Chhabra

Slide59:

SNPs have been used in mites for discriminating species and subspecies (Navajas et al. 1998), phylogeography (Brumfield et al. 2003), biodiversity assessment (Van Tienderen et al. 2002), linkage disequilibrium analysis (Akey et al. 2003), population genetic parameters (Kuhner et al. 2000) and in ecology, evolution and conservation biology (Morin et al. 2004). Applications in Entomology

Slide60:

FISH involves the preparation of short sequences of single-stranded DNA, called probes, which are complementary to the DNA sequences the researchers wish to paint and examine. These probes hybridize, or bind, to the complementary DNA and, because they are labeled with fluorescent tags, allow researchers to see the location of those sequences of DNA. Unlike most other techniques used to study chromosomes, which require that the cells be actively dividing, FISH can also be performed on non-dividing cells, making it a highly versatile procedure. What is FISH?

Forensic entomology:

Forensic entomology Forensic entomology  is the application and study of insect and other arthropod biology to criminal matters. It also involves the application of the study of arthropods, including insects, arachnids, centipedes, millipedes, and crustaceans to criminal or legal cases.

Forensic Entomology:

Forensic Entomology

Determining Postmortem Interval: Forensic Entomology:

Determining Postmortem Interval: Forensic Entomology Forensic entomology combines the study of insects and other arthropods with criminal investigations. They determine the postmortem of a corpse based on the age of the insects present in the body. To do so, they must first identify the species of the insect. Each species of insect may have vastly different habits, behaviors, and growth rates.

SAMPLE COLLECTION:

SAMPLE COLLECTION

Most commonly used insects in forensic entomology:

Most commonly used insects in forensic entomology

thanks:

thanks

authorStream Live Help