Presentation Transcript
Slide 1:MUTATION ATTCCTACTGATCGTACAATAGACAGATTAAT ATTCCTACTGATCGCACAATAGACAGATTAAT Point Mutation Susceptible Resistant A useful procedure to produce a new trait
But the normal gene is modified
A transgene is not involved
A product of mutagenesis is not GMO Gene
Slide 2:MUTATION Frame Shift ATTCCTACTGATCGTACAATAGACAGATTA aa1 aa2 aa3 aa4 aa5 aa6 aa7 aa8 aa9 aa10 Protein 1 Protein 2 Protein 3 ATTCTACTGATCGTACAATAGACAGATTA aa1 aa* aa* aa4* aa* aa* aa* aa* aa* aa* Protein 4 Protein 5 Protein 6 Deletion, addition would lead to frame shift mutation Protein changes Substitution would not change much the composition of proteins