Frame Shift Mutation

Download as
 PPT
Presentation Description 

Frame Shift Mutation

Views: 237
Like it  ( Likes) Dislike it  ( Dislikes)
Added: November 26, 2008 This Presentation is Public 
Presentation Category : Education All Rights Reserved
Tags Add Tags
Presentation Statistics
Views on authorSTREAM: 234 | Views from Embeds: 3
Others - 3 views
Presentation Transcript

Slide 1:MUTATION ATTCCTACTGATCGTACAATAGACAGATTAAT ATTCCTACTGATCGCACAATAGACAGATTAAT Point Mutation Susceptible Resistant A useful procedure to produce a new trait But the normal gene is modified A transgene is not involved A product of mutagenesis is not GMO Gene


Slide 2:MUTATION Frame Shift ATTCCTACTGATCGTACAATAGACAGATTA aa1 aa2 aa3 aa4 aa5 aa6 aa7 aa8 aa9 aa10 Protein 1 Protein 2 Protein 3 ATTCTACTGATCGTACAATAGACAGATTA aa1 aa* aa* aa4* aa* aa* aa* aa* aa* aa* Protein 4 Protein 5 Protein 6 Deletion, addition would lead to frame shift mutation Protein changes Substitution would not change much the composition of proteins