Molecular Markers in crop plants-Part 2

Views:
 
Category: Education
     
 

Presentation Description

Molecular Markers in crop plants

Comments

By: jashok (4 month(s) ago)

i liked your power point presentation on PCR-based molecular marker very much.will you please mail me .my mail add is jaiswal.mp87@gmail.com

By: leika (5 month(s) ago)

By:Medhabati k. Dear Sir, I would like to request you to mail me the power point ppt.on molecular markers. I like your presentation very much.Pliz send me through my add.Add.i sm_kangabam@yahoo.co.in Thank you.

By: rakesh.goswami12 (11 month(s) ago)

good evening sir i liked your power point presentation on PCR-based molecular marker very much.will you please mail me .my mail add is rakesh.goswami12@gmail.com. thank you very much

By: ashusamak (12 month(s) ago)

Hi sir, I am GPB student. This presentation is very nice. Can you plz send me this presentation. ashusamak@gmail.com Thank u

By: fersoy (12 month(s) ago)

Hi, this is a very informative presentation. Can you please send to figen@uludag.edu.tr Thank you

See all

Presentation Transcript

Slide 1: 

PCR-Based Molecular Markers PCR is a procedure for the in vitro enzymatic amplification of a specific segment of DNA (Mullis and Faloona, 1987).

Slide 2: 

…….AGCTAATCTAGAGAGAGAGAGAGCTAGCTGATTCAACTAC……. TCGA PCR AACTC …….TCGATTAGATCTCTCTCTCTCTCGATCGACTATG TTGAG……. New strand New strand PCR is a procedure for the in vitro enzymatic amplification of a specific segment of DNA PCR Animated 2 4 8 16 32 64 128 256 512 1024 2048 ………… No. of Copies 95oC 35-60oC 72oC

Slide 3: 

…….AGCTAATCTAGAGAGAGAGAGAGCTAGCTGATTCAACTAC……. …….TCGATTAGATCTCTCTCTCTCTCGATCGACTATGTTGATG……. New strand CTCGATCGAC New strand RAPD No cloning required No sequencing required Random primer of about 10 bp Detects several loci simultaneously Dominant marker Useful for phylogenetic studies Short primers are easily affected by annealing conditions thus are not reproducible Not useful for comparative mapping CTCGATCGAC

Slide 4: 

RAPD In this technique ………………… a single species of primer (10-base, at least 60%GC content) binds to the genomic DNA at two different sites on opposite strands of the DNA template. If these priming sites are within an amplifiable distance (2000 to 5000 bp) of each other, a discrete DNA product is produced through thermocyclic (PCR) amplification. The amplification yields many DNA fragments ranging in size from less than 100 bp to greater than 2 kb. These fragments are anonymous in the sense that their genomic origins are not known. Differences in the fragment patterns amplified from each genomic DNA sample are generally attributed to mutation at primer binding sites preventing the annealing of a primer. © A.K. Chhabra

Slide 5: 

24 Nucleotide primer …….AGCTAATCTAGAGAGAGAGAGAGCTAGCTGATTCAACTAC……. …….TCGATTAGATCTCTCTCTCTCTCGATCGACTATGTTGATG……. New strand CTCGATCGAC New strand SCAR (Sequence Characterized Amplified Region) RAPD AGCTTTTAGGCTCCATCGGATCAGTA End of RAPD Marker = STAR (Sequence Tagged Amplified Region) RAPD/AP-PCR DAF AFLP/SAMPL Product Many are codominant and their poymorphism can be increased if PCR product is digested with Restriction Enzymes.

Slide 6: 

…….AGCTAATCTAGAGAGAGAGAGAGCTAGCTGATTCAACTAC……. …….TCGATTAGATCTCTCTCTCTCTCGATCGACTATGTTGATG……. New strand New strand AFLP GATTAGATCTCTCTC Long Fixed Primer (about 15 bp) CTA Short Random Primer (2-4 bp) No cloning required No sequencing required Long Fixed Preimer + a small random primer is used Detects several loci simultaneously > RAPD > RFLP Dominant marker Useful for fingerprinting and phylogenetic studies Long primer has a fixed position, so is reproducible Not useful for comparative mapping Requires more facilities and skill

Slide 7: 

Mapping of Rf1 gene in sorghum AFLP Combination of RFLP and RAPD analysis AFLP combines the specificity of restriction analysis with PCR amplification The sequence variation detected is the same as that detected by RFLP analysis, but the number of polymorphisms detected per analysis is higher AFLP uses restriction enzyme-digested genomic DNA as the template for a PCR reaction with primers that contain the restriction enzyme recognition site as well as additional ‘arbitrary’ nucleotides that extend beyond the restriction site. By varying the number of these additional ‘arbitrary’ nucleotides that extend beyond the restriction sites into the unknown sequence, it is possible to control the proportion of the ligated fragments that could be amplified. The amplified products are then resolved by polyacrylamide gel electrophoresis. In general, 75 to 150 fragments are amplified with each primer combination, and as each fragment represents a unique site, the proportion of the genome assayed with each primer combination is much higher than with any other DNA analysis approach. 15-20 minutes © A.K. Chhabra

Slide 8: 

Sterile Fertile Bulk Sterile Bulk Fertile LICOR GEL Total No. of bands = 130-150 © A.K. Chhabra

Slide 9: 

…….AGCTAATCTAGAGAGAGAGAGAGCTAGCTGATTCAACTAC……. SSR …….TCGATTAGATCTCTCTCTCTCTCGATCGACTATGTTGATG……. (GA)5 (CT)5 GATTAGATCT GCTAGCT Sequencing required Detects FIXED LOCUS Co-dominant marker Useful for mapping studies Highly reproducible Not useful for comparative mapping Requires more facilities for Primer Synthesizing Highly polymorphic than RFLP, RAPD and AFLP More uniformly distributed in the genome Examples: 37 alleles in barley (Saghai-Maroof et al 1997) 26 alleles in soybeans (Rongwen et al. 1995)

Slide 10: 

SSRs are multiallelic (GA)20 (GA)18 (GA)15 (GA)12 (GA)4 (GA)2 P1 P2 P3 P4 P5 P6 P7 P8 P9 P10 P11 P12 © A.K. Chhabra

Multiplexing of SSRs : 

Multiplexing of SSRs Poly Poly Poly Poly Poly Poly Poly Poly Poly Mono Mono Mono Polymorphic: 9 Monomorphic: 3 Primer pairs © A.K. Chhabra Did not work

Slide 12: 

Multiplexing of SSRs Poly Poly Poly Poly Poly Poly Poly Poly Poly Mono Mono Mono Polymorphic: 9 Monomorphic: 3 © A.K. Chhabra Primer pairs M M 1 2 3 4 5 6 7 8 9 10 11 12 13

Slide 13: 

3’----- ATCTATGATATATATATATATGCATCACT -------5’ 3’----- TAGATACTATATATATATATACGTAGTGA -------5’ SSR SSRs = STRs = Microsatellites= VNTRs Simple Sequence Repeats = Simple Tamdem Repeats = Variable No. of Tamdem Repeats Microsatellite Markers Eukaryotes + Prokaryotes - STMS c/a Locus Specific PCR Sequence tagged microsatellite site Requires Cloning and Sequencing MP-PCR Microsatellite-primed PCR

Slide 14: 

…….AGCTAATCTAGAGAGAGAGAGAGCTAGCTGATTCAACTACGAGAGAGAGA……. ISSR …….TCGATTAGATCTCTCTCTCTCTCGATCGACTATGTTGATGCTCTCTCTCTCT……. CTCTCGATC TACGAGA Micrsatellite repeat anchored primers are used Sequencing required Detects FIXED LOCUS Dominant marker Useful for mapping studies Highly reproducible Requires more facilities for Primer Synthesizing Highly polymorphic than RFLP, RAPD and AFLP More uniformly distributed in the genome

Slide 15: 

STS RAPD RFLP PCR ……… Sequence should be known Design 18-20bp primer …….AGCTAATCTAGAGAGAGAGAGAGCTAGCTGATTCAACTACGAGAGAGAGA……. …….TCGATTAGATCTCTCTCTCTCTCGATCGACTATGTTGATGCTCTCTCTCTCT……. AGATCTCT CTCT CTCT CGATCGACT POLYMORPHISM PRESENT POLYMORPHISM ABSENT Use Restriction Enzymes Polymorphism Sequencing required Detects FIXED LOCUS Useful for mapping studies Highly reproducible Requires more facilities for Primer Synthesizing

Slide 16: 

EST © A.K. Chhabra …….UAGAUCUCUCUCUCUCUUCUCU……. m RNA …….ATCTAGAGAGAGAGAGAAGAGA……. c DNA 18-20 BP PRIMERS Provides Sequence Tag for a particular gene Sequencing required Detects FIXED LOCUS Useful for mapping studies Highly reproducible Requires more facilities for Primer Synthesizing

Slide 17: 

ATCTATC AACGAGC ATCTATC ATCTATC + - ATCTATC SSCPs Single Stranded Conformation Polymorphism Asymmetric PCR Less Concentration More Concentration Target Gene ds DNA ds DNA with different sequence Will Yield ss DNA. DNAs of same length with different nucleotide sequence would also show polymorphism due to formation of secondary and tertiary structures. This is otherwise not possible using dsDNA It can be used with short DNA fragments Only . Can detect variation between the fragments of equal molecular weights. 0.8% 0.8% 0.8% 0.8% 0.8% 0.6%

Slide 18: 

LRR Leucine Rich Repeat (LRR) regions Resistance Gene Analogs (RGA) in plants are related to the NBS-LRR class of disease resistance genes RGA NBS CLASSES Candidate gene approach Nucleotide Binding Site (NBS) contains several sequence motifs which are highly conserved among disease resistance RGAs Disease Resistance Gene Conserved region Conserved region WHEAT Can be used to isolate disease resistance genes in other crops like: RICE MAIZE SORGHUM FRUITS VEGETABLES etc. AGCTTTAAATCGATTCGGATT

Slide 19: 

a b WHEAT Disease 1 b a Disease 2 Disease 3 Disease 4 c c RICE MAIZE COTTON Crop Disease Genes And conserved regions RGAs Indicates conserved regions How to use RGAs Probe / primers

Slide 20: 

5’.AGCTAATCTAGAGAGAGAGAGAGCTAGCTGATTCAACTAC…….3’ SSR 3’.TCGATTAGATCTCTCTCTCTCTCGATCGACTATGTTGATG……5’ (GA)5 (CT)5 GATTAGATCT GCTAGCT Sequencing required Detects FIXED LOCUS Co-dominant marker Useful for mapping studies Highly reproducible Not useful for comparative mapping Requires more facilities for Primer Synthesizing Highly polymorphic than RFLP, RAPD and AFLP More uniformly distributed in the genome Examples: 37 alleles in barley (Saghai-Maroof et al 1997) 26 alleles in soybeans (Rongwen et al. 1995) PCR Movie

Slide 21: 

STS RAPD RFLP PCR ……… Sequence should be known Design 18-20bp primer …….AGCTAATCTAGAGAGAGAGAGAGCTAGCTGATTCAACTACGAGAGAGAGA……. …….TCGATTAGATCTCTCTCTCTCTCGATCGACTATGTTGATGCTCTCTCTCTCT……. AGATCTCT CTCT CTCT CGATCGACT POLYMORPHISM PRESENT POLYMORPHISM ABSENT Use Restriction Enzymes Polymorphism Sequencing required Detects FIXED LOCUS Useful for mapping studies Highly reproducible Requires more facilities for Primer Synthesizing PCR Movie

Slide 22: 

EST © A.K. Chhabra …….UAGAUCUCUCUCUCUCUUCUCU……. m RNA …….ATCTAGAGAGAGAGAGAAGAGA……. c DNA 18-20 BP PRIMERS Provides Sequence Tag for a particular gene Sequencing required Detects FIXED LOCUS Useful for mapping studies Highly reproducible Requires more facilities for Primer Synthesizing

Slide 23: 

ATCTATC AACGAGC ATCTATC ATCTATC + - ATCTATC SSCPs Single Stranded Conformation Polymorphism Asymmetric PCR Less Concentration More Concentration Target Gene ds DNA ds DNA with different sequence Will Yield ss DNA. DNAs of same length with different nucleotide sequence would also show polymorphism due to formation of secondary and tertiary structures. This is otherwise not possible using dsDNA It can be used with short DNA fragments Only . Can detect variation between the fragments of equal molecular weights. 0.8% 0.8% 0.8% 0.8% 0.8% 0.6%

Slide 24: 

LRR Leucine Rich Repeat (LRR) regions Resistance Gene Analogs (RGA) in plants are related to the NBS-LRR class of disease resistance genes RGA NBS CLASSES Candidate gene approach Nucleotide Binding Site (NBS) contains several sequence motifs which are highly conserved among disease resistance RGAs Disease Resistance Gene Conserved region Conserved region WHEAT Can be used to isolate disease resistance genes in other crops like: RICE MAIZE SORGHUM FRUITS VEGETABLES etc. AGCTTTAAATCGATTCGGATT PCR Movie

Slide 25: 

a b WHEAT Disease 1 b a Disease 2 Disease 3 Disease 4 c c RICE MAIZE COTTON Crop Disease Genes and conserved regions RGAs Indicates conserved regions How to use RGAs Probe / primers

Slide 26: 

001100011100010101000101 ++-++---+++++--++++++++-+- Autoradiography and Gel Scoring Feeding Data in Computer

Slide 27: 

Markers Target loci (gene dr) Closest markers RAPD RFLP AFLP EST SSR ISSR SNP CAP a b c d e f g h i j k l m n o p q s t u v w x y z 1.3 cM 110 cM Figure 1. This line diagram shows an arbitrary genetic linkage map for a target gene (say disease resistance). The black bar structure represents a particular chromosome (linkage group) of the species under study. Lines marked “a” to “z” are markers mapped flanking to disease resistance gene (dr), “k” being closest to dr gene. “k” might be a RAPD marker, or an AFLP or RFLP or EST …. or any other marker. This shows co-segregation with the dr gene, can be used as a reliable marker for disease resistance. 100% 80% Linkage Drag Understanding Linkage Map

Slide 28: 

Internal Transcribed Sequences PCR Movie

Slide 29: 

Markers Target loci (gene dr) Closest markers RAPD RFLP AFLP EST SSR ISSR SNP CAP a b c d e f g h i j k l m n o p q s t u v w x y z 1.3 cM 110 cM Anonymous markers with no known functions Anonymous markers provide different information genes proteins genomic DNA RFLPs c DNA EST RGAs etc. ISOENZYMES RFLPs SSR RAPDs etc. Scanning Regions Through Molecular Markers

A portion of LICOR gel showing co-segregating AFLP band for Rf1 gene : 

F S S F 1 S F F S A portion of LICOR gel showing co-segregating AFLP band for Rf1 gene © A.K. Chhabra

Slide 31: 

Linkage Map Linkage maps are prepared using MapMaker or any other related software. These maps show distribution of markers based on the recombination frequencies between the marker and the target gene and is measured in cM. On the genetic maps , the majority of the points consist of anonymous molecular markers and not genes of known function

Slide 32: 

Markers Target loci (gene dr) Closest markers RAPD RFLP AFLP EST SSR ISSR SNP CAP a b c d e f g h i j k l m n o p q s t u v w x y z 1.3 cM 110 cM Figure 1. This line diagram shows an arbitrary genetic linkage map for a target gene (say disease resistance). The black bar structure represents a particular chromosome (linkage group) of the species under study. Lines marked “a” to “z” are markers mapped flanking to disease resistance gene (dr), “k” being closest to dr gene. “k” might be a RAPD marker, or an AFLP or RFLP or EST …. or any other marker. This shows co-segregation with the dr gene, can be used as a reliable marker for disease resistance. 100% 80% Linkage Drag Understanding Linkage Map

Slide 33: 

SNPs Single Nucleotide Polymorphism First Generation Second Generation Third Generation Molecular markers © A.K. Chhabra

Slide 34: 

SNP ? -----AGCTTTAGTC---------- -----TCGAAATCAG---------- -------AGCTGTAGTC---------- -------TCGAAATCAG---------- NEW SAME DNA Replication SNPs are Biallelic © A.K. Chhabra

Slide 35: 

Extraordinary abundance RFLP RFLP RFLP RFLP SSR SNP Arbitrary Example RFLP = 5 forms SSR = 21 forms SNP = 63 forms Observations 1 SNP / 100-300bp dbSNP = 8,03,557 (Aug 2000) Human genome = 3,00,000 (public db) = + 5,00,000 (private sector) Estimate SNPs in human genome = 5,00,000 to 1,000,000 Density = 1 SNP / 3-5 kb Human genome = 30,000 SNPs are sufficient to scan it © A.K. Chhabra

Slide 36: 

euchromatin heterochromatin SNPs may be found both in the non-repetitive coding or regulatory sequences and I the repetitive non-coding sequences If coding sequences May or may not determine The mutant phenotype But would show 100% Co-segregation with the trait. Very useful for MAS And gene isolation If found in the proximity of Coding sequences Association with the trait may be present but will always be less Than 100% If away from the gene Of no use © A.K. Chhabra

Slide 37: 

Genome length 4330 kb Range of a gene length = 240 bp to 4800 bp No. of genes it has = 4330000 bp / 500 bp = 8660 genes Need at least 8660 markers for each gene More than 8660 markers are required Generally 3 folds than the required Because they are not uniformaly distributed in the genome Calculating No. of markers required © A.K. Chhabra

Desirable Properties of Molecular Markers : 

Desirable Properties of Molecular Markers High level of polymorphism Co-dominant inheritance Unambiguous designation of alleles Frequent occurrence in the genome Even distribution throughout the genome Selectively neutral behavior (no pleiotropic effect) Easy access (no cloning) Easy and fast assay 9amenable to automation) High reproducibility Easy exchange of data between laboratories Development at reasonable cost