logging in or signing up Molecular Markers in Crop Plants chhabra61 Download Post to : URL : Related Presentations : Share Add to Flag Embed Email Send to Blogs and Networks Add to Channel Uploaded from authorPOINT lite Insert YouTube videos in PowerPont slides with aS Desktop Copy embed code: Embed: Flash iPad Copy Does not support media & animations WordPress Embed Customize Embed URL: Copy Thumbnail: Copy The presentation is successfully added In Your Favorites. Views: 8695 Category: Education License: All Rights Reserved Like it (10) Dislike it (1) Added: November 23, 2008 This Presentation is Public Favorites: 5 Presentation Description Molecular Markers in Crop Plants Comments Posting comment... By: tarrybhatt (20 month(s) ago) Dear Sir, I liked your presentation on 'molecular markers in crop plant' very much and it is very useful for my studies. Can you please send me the presentation or allow me to download from this site ? Thank you very much in advance. Saving..... Post Reply Close Saving..... Edit Comment Close By: abdelrahmanelenany (24 month(s) ago) i abdelrahman and i went the presentation and some others but no response for my requests and thank you for any object Saving..... Post Reply Close Saving..... Edit Comment Close By: naniraj123 (24 month(s) ago) plz send me the updates about molecular charecterization of sun flower Saving..... Post Reply Close Saving..... Edit Comment Close By: pragyarathore (25 month(s) ago) kindly post this ppt to pragya_rathore@rediffmail.com.thanks Saving..... Post Reply Close Saving..... Edit Comment Close By: joshihaimil (25 month(s) ago) Very excellent n most understandable presentation sir. It is vry much useful to get the whole idea about the markers. If u dont mind can u please send this presentation to me...it is my request sir, My mail ID id notyhottyhem@gmail.com Saving..... Post Reply Close Saving..... Edit Comment Close loading.... See all Premium member Presentation Transcript Slide 1: Molecular Marker-Assisted Selection in Crop Plants (MAS) A.K. Chhabra Department of Plant Breeding CCS Haryana Agricultural University Hisar 125 004 Slide 2: x DEVELOPMENT OF MAPPING POPULATIONS Slide 4: RFLP AFLP SSR SNP RFLP AFLP SNP SSR Screening of population and parents ISOLATION OF DNA : ISOLATION OF DNA Highly Pure High throughput technique PROTOCOL depends upon the marker technique to be used Slide 6: Preparation of Gel Running of Gel Scoring of Gel Slide 7: MONOMORPHISM Vs. POLYMORPHISM V1 V2 V3 V4 V5 V6 V7 V8 V9 V10 V11 V12 V13 2 Gps. 3 Gps. 8 Gps. 11 Gps. © A.K. Chhabra Slide 8: Isozyme Markers Isoenzymes allozymes EST ADH SKDK SOD LDH ME POX Etc. SOURCE STAGE LOCATION YEAR MACRO ENVT. MICRO ENVT. PLANT PART/TISSUE Electrophoretic separation © A.K. Chhabra Slide 9: Substrate Product EST V1 V2 V3 V4 V1 Yellow V2 Red V3 Green V4 Pink © A.K. Chhabra Slide 10: Role of Isozymes (38 PAGES REVIEW ARTICLE IS ATACHED) Disease resistance Cultivar Identification Cytoplasmic diversity/cytoplasmic male sterility Genetic diversity and geographical distribution Reproduction behaviour Phylogenetic relationships Confirmation of the introgressed gene in the hybrid genome Cultivars identification Assessment of degree of isogeneicity Protogyny Chromosome depletion Tissue culture Aging effect Establishing linkage relationship(s) between d2 gene and enzymatic Markers Assessment of gametophytic competition Isozyme Markers Protocol MS Word © A.K. Chhabra Slide 11: DNA Markers AFLP Amplified Fragment Length Polymorphism ALP Amplicon Length Polymorphism AP-PCR Arbitrary Primed PCR AS-PCR Allele-specific PCR CAPS Cleaved Amplified Polymorphic Sequences DAF DNA Amplification Fingerprinting RAPD Random Amplified Polymorphic DNA RFLP Restriction Fragment Length Polymorphism SCAR Sequence Characterized Amplified Regions SSCP Single Strand Cofirmational Polymorphism SSR Simple Sequence Repeats SSLP Microsaterllite Simple Sequence Length Polymorphism Minisatellite Simple Sequence Length Polymorphism STS Sequence Tagged Sites SNP Single Nucleotide Polymorphism AFLP Amplified Fragment Length Polymorphism ALP Amplicon Length Polymorphism AP-PCR Arbitrary Primed PCR AS-PCR Allele-specific PCR CAPS Cleaved Amplified Polymorphic Sequences DAF DNA Amplification Fingerprinting RAPD Random Amplified Polymorphic DNA RFLP Restriction Fragment Length Polymorphism SCAR Sequence Characterized Amplified Regions SSCP Single Strand Cofirmational Polymorphism SSR Simple Sequence Repeats SSLP Microsaterllite Simple Sequence Length Polymorphism Minisatellite Simple Sequence Length Polymorphism STS Sequence Tagged Sites SNP Single Nucleotide Polymorphism A Brief Discussion and Uses of DNA Markers……. © A.K. Chhabra Slide 12: DNA Markers as Fundamental Links between Plant Breeding and Plant Biology Assessing Genetic Diversity and Merit A. Germ Plasm Identification, Classification, and Management B. Parent Selection C. Limits of Assessing Genetic Diversity via DNA Markers Genome Architecture: Genetic and Physical Characterization of Crop Plant Genomes A. Development of Integrated Maps B. Relating Genetic and Physical Distances in Crop Plant Genomes C. Insights into Recombination and Its Role in Generating Genetic Variation D. Map-Based Cloning Comes of Age Analysis of Complex Traits and Phenomena A. Quantitative Inheritance Patterns B. Assessing and Introgressing Exotic Germ Plasm C. Response to Selection in Plant Breeding Programs Marker-Assisted Selection A. Deterministic and Simulation Studies of MAS in Plant Breeding Programs B. Empirical Results C. Integrating MAS into Plant Breeding Programs DNA Markers in Cultivar Development Programs © A.K. Chhabra Slide 13: RFLP markers arise as a result of Mutations: substitution of a single nucleotide rearrangements in the DNA intervening between two restriction sires Such rearrangements might include deletion insertion and/or transposition or error in DNA replication. © A.K. Chhabra Slide 14: How Substitution leads to RFLP………………… AGCTTATTCGGATTCAAGGATCCTTCGGATTCAACTA MUTATED G to T AGCTTATTCGTATTCAAGGATCCTTCGG ATTCAACTA RESTRICTION FRAGMENTS AGCTTATTCGGTTTCAAGGATCCTTCGGATTCAACTA Results into Restriction Fragment Length POLYMOPRPHISM deletion insertion and/or transposition or error in DNA replication ACT IN THE SAME WAY © A.K. Chhabra Slide 15: RFLP Technique DNA isolation (text file) Digestion of the DNA with a restriction enzyme Separation of the restricted fragments by agarose gel electrophoresis/PAGE Southern Blotting Detection of individual restriction fragments by nucleic acid hybridization with labeled cloned probes, Scoring of RFLPs by direct observation of autoradiograms. © A.K. Chhabra RFLP ANIMATED Slide 16: Fingerprinting Example How it is done? Technique © A.K. Chhabra Slide 17: Sponge Dry Tissue Papers Weight Southern Blotting (Southern, 1975) Gel DNA Nitrocellulose membrane Slide 18: Probing / Hybridization Slide 19: 001100011100010101000101 ++-++---+++++--++++++++-+- Autoradiography and Gel Scoring Feeding Data in Computer Slide 20: mtDNA RFLP Cytoplasmic male sterility sources in pearl millet Haplotype Concept 1 Calculations Slide 21: drDNA Dispersed repetitive DNA for fingerprinting c/a Oligonucleotide in-gel hybridization OR Oligonucleotide in-gel Fingerprinting Same as RFLP EXCEPT S-Blotting step is excluded (gels are dried and used directly for hyb.) Probe used is a REPETITIVE DNA SEQUENCE (SSR, VNTRs, STRs etc.) ADVANTAGE: Repeat sequences used are multilocus probes thus reveal polymorphism at many loci simultaneously DISADVANTAGE: Sometimes gives less no. of bands eg. In wheat and tomato. 2-15bp length You do not have the permission to view this presentation. In order to view it, please contact the author of the presentation.
Molecular Markers in Crop Plants chhabra61 Download Post to : URL : Related Presentations : Share Add to Flag Embed Email Send to Blogs and Networks Add to Channel Uploaded from authorPOINT lite Insert YouTube videos in PowerPont slides with aS Desktop Copy embed code: Embed: Flash iPad Copy Does not support media & animations WordPress Embed Customize Embed URL: Copy Thumbnail: Copy The presentation is successfully added In Your Favorites. Views: 8695 Category: Education License: All Rights Reserved Like it (10) Dislike it (1) Added: November 23, 2008 This Presentation is Public Favorites: 5 Presentation Description Molecular Markers in Crop Plants Comments Posting comment... By: tarrybhatt (20 month(s) ago) Dear Sir, I liked your presentation on 'molecular markers in crop plant' very much and it is very useful for my studies. Can you please send me the presentation or allow me to download from this site ? Thank you very much in advance. Saving..... Post Reply Close Saving..... Edit Comment Close By: abdelrahmanelenany (24 month(s) ago) i abdelrahman and i went the presentation and some others but no response for my requests and thank you for any object Saving..... Post Reply Close Saving..... Edit Comment Close By: naniraj123 (24 month(s) ago) plz send me the updates about molecular charecterization of sun flower Saving..... Post Reply Close Saving..... Edit Comment Close By: pragyarathore (25 month(s) ago) kindly post this ppt to pragya_rathore@rediffmail.com.thanks Saving..... Post Reply Close Saving..... Edit Comment Close By: joshihaimil (25 month(s) ago) Very excellent n most understandable presentation sir. It is vry much useful to get the whole idea about the markers. If u dont mind can u please send this presentation to me...it is my request sir, My mail ID id notyhottyhem@gmail.com Saving..... Post Reply Close Saving..... Edit Comment Close loading.... See all Premium member Presentation Transcript Slide 1: Molecular Marker-Assisted Selection in Crop Plants (MAS) A.K. Chhabra Department of Plant Breeding CCS Haryana Agricultural University Hisar 125 004 Slide 2: x DEVELOPMENT OF MAPPING POPULATIONS Slide 4: RFLP AFLP SSR SNP RFLP AFLP SNP SSR Screening of population and parents ISOLATION OF DNA : ISOLATION OF DNA Highly Pure High throughput technique PROTOCOL depends upon the marker technique to be used Slide 6: Preparation of Gel Running of Gel Scoring of Gel Slide 7: MONOMORPHISM Vs. POLYMORPHISM V1 V2 V3 V4 V5 V6 V7 V8 V9 V10 V11 V12 V13 2 Gps. 3 Gps. 8 Gps. 11 Gps. © A.K. Chhabra Slide 8: Isozyme Markers Isoenzymes allozymes EST ADH SKDK SOD LDH ME POX Etc. SOURCE STAGE LOCATION YEAR MACRO ENVT. MICRO ENVT. PLANT PART/TISSUE Electrophoretic separation © A.K. Chhabra Slide 9: Substrate Product EST V1 V2 V3 V4 V1 Yellow V2 Red V3 Green V4 Pink © A.K. Chhabra Slide 10: Role of Isozymes (38 PAGES REVIEW ARTICLE IS ATACHED) Disease resistance Cultivar Identification Cytoplasmic diversity/cytoplasmic male sterility Genetic diversity and geographical distribution Reproduction behaviour Phylogenetic relationships Confirmation of the introgressed gene in the hybrid genome Cultivars identification Assessment of degree of isogeneicity Protogyny Chromosome depletion Tissue culture Aging effect Establishing linkage relationship(s) between d2 gene and enzymatic Markers Assessment of gametophytic competition Isozyme Markers Protocol MS Word © A.K. Chhabra Slide 11: DNA Markers AFLP Amplified Fragment Length Polymorphism ALP Amplicon Length Polymorphism AP-PCR Arbitrary Primed PCR AS-PCR Allele-specific PCR CAPS Cleaved Amplified Polymorphic Sequences DAF DNA Amplification Fingerprinting RAPD Random Amplified Polymorphic DNA RFLP Restriction Fragment Length Polymorphism SCAR Sequence Characterized Amplified Regions SSCP Single Strand Cofirmational Polymorphism SSR Simple Sequence Repeats SSLP Microsaterllite Simple Sequence Length Polymorphism Minisatellite Simple Sequence Length Polymorphism STS Sequence Tagged Sites SNP Single Nucleotide Polymorphism AFLP Amplified Fragment Length Polymorphism ALP Amplicon Length Polymorphism AP-PCR Arbitrary Primed PCR AS-PCR Allele-specific PCR CAPS Cleaved Amplified Polymorphic Sequences DAF DNA Amplification Fingerprinting RAPD Random Amplified Polymorphic DNA RFLP Restriction Fragment Length Polymorphism SCAR Sequence Characterized Amplified Regions SSCP Single Strand Cofirmational Polymorphism SSR Simple Sequence Repeats SSLP Microsaterllite Simple Sequence Length Polymorphism Minisatellite Simple Sequence Length Polymorphism STS Sequence Tagged Sites SNP Single Nucleotide Polymorphism A Brief Discussion and Uses of DNA Markers……. © A.K. Chhabra Slide 12: DNA Markers as Fundamental Links between Plant Breeding and Plant Biology Assessing Genetic Diversity and Merit A. Germ Plasm Identification, Classification, and Management B. Parent Selection C. Limits of Assessing Genetic Diversity via DNA Markers Genome Architecture: Genetic and Physical Characterization of Crop Plant Genomes A. Development of Integrated Maps B. Relating Genetic and Physical Distances in Crop Plant Genomes C. Insights into Recombination and Its Role in Generating Genetic Variation D. Map-Based Cloning Comes of Age Analysis of Complex Traits and Phenomena A. Quantitative Inheritance Patterns B. Assessing and Introgressing Exotic Germ Plasm C. Response to Selection in Plant Breeding Programs Marker-Assisted Selection A. Deterministic and Simulation Studies of MAS in Plant Breeding Programs B. Empirical Results C. Integrating MAS into Plant Breeding Programs DNA Markers in Cultivar Development Programs © A.K. Chhabra Slide 13: RFLP markers arise as a result of Mutations: substitution of a single nucleotide rearrangements in the DNA intervening between two restriction sires Such rearrangements might include deletion insertion and/or transposition or error in DNA replication. © A.K. Chhabra Slide 14: How Substitution leads to RFLP………………… AGCTTATTCGGATTCAAGGATCCTTCGGATTCAACTA MUTATED G to T AGCTTATTCGTATTCAAGGATCCTTCGG ATTCAACTA RESTRICTION FRAGMENTS AGCTTATTCGGTTTCAAGGATCCTTCGGATTCAACTA Results into Restriction Fragment Length POLYMOPRPHISM deletion insertion and/or transposition or error in DNA replication ACT IN THE SAME WAY © A.K. Chhabra Slide 15: RFLP Technique DNA isolation (text file) Digestion of the DNA with a restriction enzyme Separation of the restricted fragments by agarose gel electrophoresis/PAGE Southern Blotting Detection of individual restriction fragments by nucleic acid hybridization with labeled cloned probes, Scoring of RFLPs by direct observation of autoradiograms. © A.K. Chhabra RFLP ANIMATED Slide 16: Fingerprinting Example How it is done? Technique © A.K. Chhabra Slide 17: Sponge Dry Tissue Papers Weight Southern Blotting (Southern, 1975) Gel DNA Nitrocellulose membrane Slide 18: Probing / Hybridization Slide 19: 001100011100010101000101 ++-++---+++++--++++++++-+- Autoradiography and Gel Scoring Feeding Data in Computer Slide 20: mtDNA RFLP Cytoplasmic male sterility sources in pearl millet Haplotype Concept 1 Calculations Slide 21: drDNA Dispersed repetitive DNA for fingerprinting c/a Oligonucleotide in-gel hybridization OR Oligonucleotide in-gel Fingerprinting Same as RFLP EXCEPT S-Blotting step is excluded (gels are dried and used directly for hyb.) Probe used is a REPETITIVE DNA SEQUENCE (SSR, VNTRs, STRs etc.) ADVANTAGE: Repeat sequences used are multilocus probes thus reveal polymorphism at many loci simultaneously DISADVANTAGE: Sometimes gives less no. of bands eg. In wheat and tomato. 2-15bp length