RNA & Transcription PowerPoint

Views:
 
Category: Education
     
 

Presentation Description

No description available.

Comments

Presentation Transcript

PowerPoint Presentation:

Protein Synthesis Part 1 Transcription RNA And

PowerPoint Presentation:

DNA contains genes , sequences of nucleotide bases . These genes code for proteins. Proteins are used to build cells and do much of the work inside cells. Examples of proteins include enzymes , pigments, and antibodies ! Deoxyribonucleic Acid

PowerPoint Presentation:

Proteins are made of amino acids linked together by peptide bonds. 20 different amino acids exist. Genes & Proteins

PowerPoint Presentation:

DNA is found inside the nucleus . Proteins, however, are made in the cytoplasm of cells by organelles called ribosomes. Ribosomes may be free in the cytoplasm or attached to the surface of rough ER . DNA Begins the Process

PowerPoint Presentation:

DNA’s code is copied and taken to the cytoplasm by a type of RNA (Ribonucleic Acid) called mRNA. In the cytoplasm, this code carried by mRNA must be read so amino acids can be assembled to make proteins. This process is called PROTEIN SYNTHESIS . RNA Continues the Process

PowerPoint Presentation:

1. RNA has the sugar ribose . DNA has the sugar deoxyribose. 2. RNA has the base uracil (U). DNA has the base thymine (T). 3. RNA molecule is single-stranded . DNA molecule is double-stranded. Ribose vs. Deoxyribose RNA Differs from DNA

PowerPoint Presentation:

Structure of RNA

PowerPoint Presentation:

Messenger RNA (mRNA) copies DNA’s code & carries the genetic information to the ribosomes. Ribosomal RNA (rRNA) , along with protein, makes up the ribosomes. Transfer RNA (tRNA) transfers amino acids to the ribosomes where proteins are synthesized. Three Types of RNA

PowerPoint Presentation:

messenger RNA mRNA is a single-stranded RNA molecule that carries the instructions from a gene to make a protein. Contains the Nitrogen Bases A, G, C, U ( no T ). In eukaryotic cells, mRNA carries the genetic “message” from DNA in the nucleus to the ribosomes in the cytoplasm.

PowerPoint Presentation:

Now that we know all about RNA , let’s make some proteins ! This order of events is called the central dogma of molecular biology : DNA RNA P R O T E I N Makin’ Proteins

PowerPoint Presentation:

Occurs in TWO stages: Transcription Translation Makin’ Proteins

PowerPoint Presentation:

Transcription 6 Steps The process by which the genetic instructions in a specific gene are transcribed or “rewritten” into an RNA molecule. Takes place in the nucleus of eukaryotic cells.

PowerPoint Presentation:

RNA Transcription Step 1: A special enzyme called RNA polymerase attaches to the DNA at the promoter , the starting point in the DNA for transcription. Hydrogen bonds between base pairs break and DNA “ unzips ”

PowerPoint Presentation:

RNA Transcription Step 2: DNA strands pull apart from each other

PowerPoint Presentation:

RNA Transcription Step 3 : RNA polymerase finds RNA nucleotides in the cell and matches them up with only one side of the “unzipped” DNA The “unzipped’ strand forms a template (a model) for making an mRNA strand RNA nucleotide

PowerPoint Presentation:

RNA Transcription Step 4 : RNA polymerase continues to match up nucleotides with “unzipped” DNA until it reaches a point in the DNA called the termination signal that says “ STOP !” The termination signal is a specific sequence of nucleotides that marks the end of a gene. mRNA strand One side of DNA strand

PowerPoint Presentation:

RNA Transcription Step 5 : mRNA strand breaks off from the DNA strand and leaves the nucleus for the ribosome mRNA strand

PowerPoint Presentation:

RNA Transcription Step 6: Once the mRNA leaves, the DNA “ zips ” back together!

PowerPoint Presentation:

After the newly made mRNA leaves the nucleus, it attaches to a ribosome where it will direct translation, the second stage of protein synthesis. 1 2 3 After Transcription

PowerPoint Presentation:

Try it! What RNA strand will be made from the following DNA sequence? TACGCATGACTAGCAAGTCTAACT Transcription

PowerPoint Presentation:

Try it! What mRNA strand will be made from the following DNA sequence during transcription? DNA: TACGCATGACTAGCAAGTCTAACT mRNA: AUGCGUACUGAUCGUUCAGAUUGA Transcription

PowerPoint Presentation:

Each 3 nucleotide sequence in mRNA is called a codon and codes for a specific amino acid. Now, divide your mRNA into codons: mRNA: AUGCGUACUGAUCGUUCAGAUUGA mRNA codons : AUG-CGU-ACU-GAU-CGU-UCA-GAU-UGA Codons

PowerPoint Presentation:

Watch this animation: http://www.stolaf.edu/people/giannini/flashanimat/molgenetics/transcription.swf Transcription

authorStream Live Help