The Paradigms of Synthetic Biology

Views:
 
     
 

Presentation Description

No description available.

Comments

By: aparnaB (79 month(s) ago)

yes...surely...

By: jackyoung (84 month(s) ago)

Hi, would it be possible to use the slides in my class (jayoung50@aim.com)

Presentation Transcript

PowerPoint Presentation:

The Paradigms of Synthetic Biology Dissertation work presented by: Aparna Banerjee Registration No. 337 of 2010-2011 Roll. VU/PG/BIT-IVS No. 31 Vidyasagar University

PowerPoint Presentation:

What is Synthetic Biology? Chemical synthesis of biological components, Biological synthesis of chemicals, Engineering principles to design novel biological systems. This is the “Grand Synthesis” of the disciplines: Molecular biology, Cell biology, Biochemistry, Genetics, Bio Engineering, Electrical Engineering Escherichia coli producing different colours Synthetic Biology.. Recreating the cells

PowerPoint Presentation:

Goals of Synthetic Biology… Understand functions and connectivity of hierarchical biological systems: Characterize natural design principles of modular biology: Use all these knowledge to design & engineer novel /improved biological system : Hierarchical & Modular organization makes synthetic biology possible & understandable.

PowerPoint Presentation:

Major thrusts of Synthetic Biology DNA assembly Genetic regulation Chromosomal manipulation Metabolic pathway optimization Cell state reporting Artificial cells & cell structures

PowerPoint Presentation:

1) DNA assembly A. BioBrick approach Facilitate part reuse, So no need of PCR reamplification every time Only 4 restriction enzymes required No control over 6-bp scars of every binary assembly UC Berkeley BglBrick standard B. SLIC approach S equence and L igase I ndependent C loning ( Li 2007 ) Assembly is standardized , So it always use same reaction components & conditions It is scar-less, as resulting assembly is pre-designed & sequence independent

PowerPoint Presentation:

C. Gibson approach No dNTP addition step Use a ligase to seal single stranded nicks, which boost assembly Highly sequence independent, scar-less & standardized T5 exonuclease, Fusion polymerase & Taq ligase are more expensive than SLIC. Gibson method works on DNA fragments > 250 bp length or longer, as T5 exonuclease entirely cleave short DNA fragment before annealing and prime Fusion polymerase for extension. D. CPEC approach C ircular P olymerase E xtension C loning ( Quan 2009 ) ( Gibson 200 9 ) No exonuclease used No dNTP addition Only a fusion polymerase required, as the assembly occurres at high temperature Polymerase derived mutations are possible

PowerPoint Presentation:

SLIC/ GIBSON/ CPEC similarities: Start with same materials and result in same final products. So, assembly design is same to all . SLIC/Gibson/CPEC limitations: DNA fragment termini to be assembled can not have stable ssDNA secondary structure, like-hairpin or stem-loop ; as it directly primes neighboring fragments. Repeated sequences are obstacles , if 2 distinct assembly fragments are identical at 1 terminus, assembly do not contain all parts or contain wrongly arranged parts. Not optimal choice for combinatorial assembly, as it preclude reuse of same homology sequences throughout all combinations.

PowerPoint Presentation:

Hierarchical assembly is not possible. More sequence dependent than SLIC/Gibson method E. Golden Gate Approach Recent MoClo ( Weber 2011 ) & GoldenBraid ( Sarrion-Perdigones 2011 ) approach give scar-less, full multi-part assembly for almost all construct. MoClo carries a sizable plasmid & requires many stages to reach final product. GoldenBraid approach is same yet simple & only requires 4 intermediate vectors and only few parts can be put together each step than MoClo.

PowerPoint Presentation:

2) Genetic Regulation Synthetic Ribosome

PowerPoint Presentation:

TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGCACTACCTCTGGCGGTGATA CAGTACACAACTTCGCTCGTAGTTC ATGACGATGCATGCACGCAGTGCGACATCACAGTGTGCGACACGACGTGTGACACAGTGTGACTACACGAGTGTGCACTACACGAACGATGCACTACAGTTGGTGCATCACGTGTGTGCATCAGTTGGCGCGACTACAGTGTGCATCACAGTGTGCATCACGATTAA CGAGTTGCGCACACTATGTCCCCCCCCCGGGGGGGGGCACUUUUCUUCUUCUUUCGACGACTATGTGCATCAAGCATCACTG So, modulating RBS sequence is necessary. Benefits of designing synthetic ribosome (Adam A, 2008) A. Designing synthetic Ribosome

PowerPoint Presentation:

B. Modifying regulatory feedbacks Bacterial system switched among different states by red light. System consists of a synthetic sensor kinase that allows lawn of bacteria to function as biological film. Projection of a pattern of light on bacteria produces a high-definition (100 mp/inch 2 ), two-dimensional chemical image. It can be used to control over phosphorylation steps. (Levskaya et al, 2005) 2 component sensor system in E. coli responding different light stimuli: (Voigt et al, 2010)

PowerPoint Presentation:

Optogenic Regulation (Tabor et al & Ye et al 2009)

PowerPoint Presentation:

3) Metabolic Pathway Optimization A. Controlling Metabolic Flux in Mevalonate Pathway Engineered metabolic pathways in heterologous host often suffer flux imbalances, as it lack regulatory mechanisms of natural metabolism. To increase the efficiency, synthetic protein scaffolds were prepared. Scaffold having interaction domains from metazoan signaling protein tagged to peptide ligands. 3 mevalonate pathway enzymes attached to synthetic complex & so to achieve 77-fold improvement in product with low enzyme expression & reduced metabolic load.

PowerPoint Presentation:

Synthetic scaffold made from modular protein-protein interaction domain shows best control on metabolic flux (Keasling et al, 2009) Engineered Mevalonate pathway in E. coli from Yeast

PowerPoint Presentation:

B. Pathway Chromosomal Integration By recombinant DNA technology, single copy genes can be integrated together & stable pathway expression product can be generated. (Tyo et al, 2009)

PowerPoint Presentation:

4) Chromosomal Manipulation Multiplex Automated Genome Engineering r apid & continuously generate diverse genetic changes. It optimize 1-deoxy- d -xylulose-5-phosphate(DXP) biosynthesis pathway in E. coli , overproducing industrially important isoprenoid: lycopene . 24 intermediates of DXP pathway modified creating synthetic DNA, over 4.3 billion combinatorial variants. MAGE site-specifically replace all 314 TAG stop codon with TAA across 32 E. coli strains & measure individual recombination frequency, confirming viability of each modification & identify its associated phenotypes. (Wang et al, 2009) Hierarchical Conjugative Assembly Genome Engineering merge all these codon modification in genome with 80 change & demonstrate these codon substitution can combine to higher strain without lethal effect. (Issacs et al, 2011) A. MAGE & CAGE

PowerPoint Presentation:

B. Chromosomal Insertion & Expansion Chemically induced chromosomal evolution for chromosomal insertion and expansion (Tyo et al, 2009) Chemically induced chromosomal evolution (CIChE) evolves chromosome of a microorganism to produce many copies of a recombinant allele. CIChE, plasmid-free, high gene copy expression system to engineer E. coli uses E. coli recA homologous recombination & evolve a gene of ~40 copies of a recombinant pathway.

PowerPoint Presentation:

5) Cell State Reporting A novel biosensor strain for detection & quantification of a small molecule, mevalonate is invented. The biosensor strain is an Escherichia coli mevalonate auxotroph which expresses green fluorescent protein & reports on mevalonate concentration in growth media by a change in growth rate. (Pfleger et al, 2007) Construction of a mevalonate biosensor in 96 well plates with 4 controls in each

PowerPoint Presentation:

6) Artificial Cells & Cellular Structures Fatty acids and their corresponding alcohols & glycerol monoesters are important components of protocell membranes , because they are simple amphiphiles. It form bilayer membrane vesicles, which retain encapsulated oligonucleotides and capable of growth & division. Such membrane allow passage of charged molecules, like nucleotide, so that activated nucleotides added to outside protocell. They spontaneously cross membrane & efficiently take part in template copying in protocell interior. Permeability property of membrane shows: Primitive protocell may acquire complex nutrient from its surrounding in absence of any macromolecular transport system & become obligate heterotroph . Conceptual model of a heterotrophic protocell (Mansy et al, 2009)

PowerPoint Presentation:

Design, synthesis & assembly of 1.08 mega base pair Mycoplasma mycoides JCVI-syn1.0 genome is done from digitized gene sequence information & transplanting it into a M. capricolum recipient cell to create new M. mycoides cell which is controlled only by synthetic chromosome. The Only DNA in cell is designed synthetic DNA sequence , including designed gene deletion, polymorphism & mutation acquired during building process. New cell has desired phenotypic properties & capable of continuous self-replication. Assembly of synthetic Mycoplasma mycoides genome in yeast Craig Venter et al, 2011

PowerPoint Presentation:

Current Scenario of Synthetic Biology in India

PowerPoint Presentation:

Future prospects of Synthetic Biology … Engineering microbes to produce more Biofuels Bioprospecting Bioremediation Real World Therapeutics Agriculture/Crop engineering Microbial host engineering, e.g. Antibiotic Resistance

PowerPoint Presentation:

References Mansy S , Schrum J , Krishnamurthy M , Tobe S , Treco D , Szostak J Template-directed Synthesis of a Genetic Polymer in a Model Protocell doi:10.1038/nature07018 (2008) Pfleger B, Pitera1 D, Smolke C, Keasling J Combinatorial engineering of intergenic regions in operons tunes expression of multiple genes doi:10.1038/nbt1226 (2006) Pflegera B, Piteraa D, Newmana J, Martina V, Keasling J Microbial sensors for small molecules: Development of a mevalonate biosensor doi:10.1016/j.ymben.2006.08.002 (2007) Tabor J, Levskaya A, Voigt C Multichromatic Control of Gene Expression in Escherichia coli doi:10.1016/j.jmb.2010.10.038 J. Mol. Biol. (2011) 405, 315–324 Tyo K, Ajikumar P, Stephanopoulos G Stabilized gene duplication enables long-term selection-free heterologous pathway expression doi:10.1038/nbt.1555 (2009) Yeates T, Kerfeld C, Heinhorst S, Cannon G, Shively J Protein-based organelles in bacteria: carboxysomes and related microcompartments doi:10.1038/nrmicro1913 (2008) Yu B, Kang K, Lee J, Sung B, Kim M, Kim S Rapid and efficient construction of markerless deletions in the Escherichia coli genome doi:10.1093/nar/gkn359 (2008) Dryden K, Crowley C, Tanaka S, Yeates T, Yeager M Two-dimensional crystals of carboxysome shell proteins recapitulate the hexagonal packing of three-dimensional crystals DOI: 10.1002/pro.272 (2009) Savage D Spatially ordered dynamics of the bacterial carbon fixation Machinery DOI: 10.1126/Science. 1186090 Science 327 , 1258 (2010) DNA Assembly Method Standardization for Synthetic Biomolecular Circuits and Systems by Nathan J. Hillson http://www.jbei.org http://www.syntheticbiology.org

PowerPoint Presentation:

“ Synthetic Biology is synthetically possible in lab… But crossing the boundaries of social & ethical values how long it can walk?”

authorStream Live Help