Protein Synthesis

Protein Synthesis : 

Protein Synthesis Woodinville Montessori School 9th Grade Biology Alaine Davis

Review of DNA : 

Review of DNA DNA stands for deoxyribonucleic acid DNA consists of 4 nucleotides that, with a sugar-phosphate backbone, make up the double-stranded DNA Cytosine (C) pairs with Guanine (G) Adenine (A) pairs with Thymine (T)

DNA  Protein : 

DNA  Protein The purpose of DNA is to code for a variety of proteins Think about this process in terms of genotype and phenotype: The pattern of nucleotides (eg. A T T G G G C A T) is the genotype The protein it codes for is the phenotype (physical manifestation)

The Big Picture : 

The Big Picture DNA contains genes that need to be made into proteins But DNA can’t leave the nucleus DNA is copied to messenger RNA (ribonucleic acid) - TRANSCRIPTION RNA leaves the nucleus and goes into the cytoplasm Ribosomes in the cytoplasm turn the RNA into a protein - TRANSLATION

Protein Synthesis : 

Protein Synthesis Let’s look at the process of protein synthesis in more detail, starting with the first step: DNA contains genes that need to be made into proteins One gene at a time will be copied and made into a protein A gene consists of 1,000 – 10,000 bases, like ATTTGCCTAGCTAAAGTTTCGAAGTTTCCAAA…

The Analogy : 

The Analogy DNA is like 9th grade students who are having lunch prepared for them by the other students 9th graders have the important information (what they want for lunch); however, they aren’t allowed to leave the 9th grade room (they like it in there anyway).

The Analogy : 

The Analogy The 9th grade student places an order. I’d like a bacon, lettuce & tomato sandwich, barbeque chips, and a strawberry smoothie.

The Analogy : 

The Analogy Since the 9th graders can’t leave the room, how will they get their food prepared? They need a responsible 8th grade student to come and take their orders

Protein Synthesis: Transcription : 

Protein Synthesis: Transcription Messenger RNA (mRNA) can travel between the nucleus and cytoplasm, just like an 8th grader can sometimes go into and out of the 9th grade room mRNA enters the nucleus and transcribes (copies) the DNA message Remember that RNA uses its own code (like a server may use abbreviations to write down your order) RNA uses complementary base pairs to copy the message, but it uses Uracil (U) in place of Thymine (T)

The Analogy : 

The Analogy BLT, BBQ chips & strawberry smoothie. Got it.

DNA & RNA Compared : 

DNA & RNA Compared DNA (deoxyribonucleic acid) Double-stranded Nucleotides are Cytosine, Adenine, Guanine and Thymine Sugar is deoxyribose Cannot leave the nucleus RNA (ribonucleic acid) Single-stranded Nucleotides are Cytosine, Adenine, Guanine and Uracil Sugar is ribose Can be inside or outside of nucleus

Transcription is the copying of DNA to RNA : 

Transcription is the copying of DNA to RNA

Protein Synthesis : 

Protein Synthesis After the mRNA transcribes the DNA message it has its introns removed. Introns are parts of DNA that don’t code for proteins. We think they are evolutionary “junk” left over from long ago. They also may have some sort of protective function to protect DNA from mutations. The process of having introns removed and them getting put back together into a strand of RNA is called splicing. The RNA pieces that do code for proteins are called exons

Splicing : 

Splicing

The Analogy : 

The Analogy What could represent the removal of introns and splicing of mRNA in our analogy?

Protein Synthesis : 

Protein Synthesis Then mRNA leaves the nucleus and goes into the cytoplasm It needs to get to a ribosome, because ribosomes have the ability to translate mRNA into protein chains

mRNA Translation : 

mRNA Translation The translation of mRNA to a protein takes place with the help of another type of RNA, transfer RNA (tRNA) tRNA comes in many different varieties—as many as there are codons for amino acids. Each tRNA has an anticodon that matches one—and only one—codon of mRNA

The Analogy : 

Strawberries. The Analogy In our analogy, tRNA represents a 7th grade student who is sent to fetch a particular ingredient. Each 7th grade student has one—and only one—ingredient to fetch.

The Analogy : 

The Analogy What does the ribosome represent in our analogy?

Ribosome = Kitchen : 

Ribosome = Kitchen Because that is where the individual ingredients (amino acids) brought by the tRNA (7thgraders) are put together to make proteins (lunch for 9th graders)

Review : 

Review DNA contains genes that need to be made into proteins But DNA can’t leave the nucleus DNA is copied to messenger RNA (ribonucleic acid) - TRANSCRIPTION RNA leaves the nucleus and goes into the cytoplasm Ribosomes in the cytoplasm turn the RNA into a protein - TRANSLATION