Comparative studies on sensitivity of PCR and microscopic

Slide 1: 

In The Name Of Allah, Who is the most beneficent and merciful

PRESENTOR : 

PRESENTOR MUHAMMAD AFZAAL (2006-VA-33) CONTRIBUTORS: MUHAMMAD ASIF MUBARAK(2006-va-32) MOHSIN ALI (2006-va-30)

Comparative Studies On Sensitivity of PCR And Microscopic Examination For The Detection Of Trypanosoma evansi In HorsesMuhammad Asif Muieed : 

Comparative Studies On Sensitivity of PCR And Microscopic Examination For The Detection Of Trypanosoma evansi In HorsesMuhammad Asif Muieed

Introduction : 

Introduction Horse is considered as a symbol of superiority among horse breeders due to their memorial role in history. A major tool of military transportation in siachin glacier and Kashmir Used in games like polo.derby race while the rangers and police use it for patrolling and at public level used for transportation Trypanosomiasis (surra)…….main obstacle in profitable development of horse industry Trypanosoma evansi…..first trypanosome shown to be pathogenic for mammals Clinical signs….Emaciation,oedema,hemmorhages at the mucocutaneous junction,intermittent fever

Slide 5: 

Trypanosomiasis are never pathognomic and suspicion needs to be confirmed by laboratory methods Sensitivity by the examination of thick or thin blood films is very low but depends on examiners experience and parasitaemia Microhaematocrit centrifugation technique, phase contrast Buffy coat technique, anion exchange and cultivation;….rely on detection of live .motile trypanosomes and species identification is difficult Serological tests like ELISA and CARD Agglutination test……species specificity is low PCR is extremely sensitive; even minute quantities of parasite DNA can be amplified to detectable quantity and in this no need to use radioisotopes like in DNA probes Keeping in view the present research project was designed to study the efficacy of PCR in comparison to the microscopic examination and to standardize the specific ,modern biological technique

MATERIALS AND METHODSMICROSCOPIC EXAMINATION : 

MATERIALS AND METHODSMICROSCOPIC EXAMINATION SELECTION OF EXPERIMENTAL ANIMALS(Total of 100 horses of either sex and all ages were selected) COLLECTION OF BLOOD SAMPLES(From ear vein and jugular vein) PREPARATION OF BLOOD SMEARS( By Benjamin method) FIXATION OF BLOOD SMEARS(As by Benjamin method) STAINING OF BLOOD SMEARS(As by Benjamin method,giemsa stain) EXAMINATION OF BLOOD SMEARS(under 100X lens for presence of Trypanosoma evansi,monomorphic in character, slender in shape,undulating membrane with free flagellum present outside the cell)

PCR : 

PCR Standardization of DNA extraction protocol……….Protocol for DNA extraction,storage of DNA,Confirmation of DNA PCR Amplification……….Primer set used, reaction mixture, Amplification conditions Detection of PCR amplified target DNA……..Preparation of gel, preparation of gel tray and pouring of gel, preparation of samples, loading the samples, running the gel, photography

PROTOCOL FOR DNA EXTRACTION : 

PROTOCOL FOR DNA EXTRACTION CHEMICALS AND REAGENTS 1 N Naoh,phenol-chloroform- iso amyl alcohol(25:24:1),absolute ethanol Collect 500 ul of whole blood in eppendrof tube Add 166ul of Naoh to it Boil the sample in water bath for 5 minutes Add equal volume of isoamylalcohol mixture to it Centrifuge the mixture at 13000 rpm for 10 minutes and collect aqueous phase Mix the aqueous phase with absolute ethanol and incubate at -20 degree Celsius for 30 minutes for genomic DNA precipitation Concentrate DNA by centrifugation at 13000 rpm for 10 minutes Invert the tube and drain onto clean absorbent paper. this way DNA pellet is obtained Dissolve DNA in 20 ul of deionised water

Storage and confirmation of DNA : 

Storage and confirmation of DNA DNA is stored at -20 degree Celsius For confirmation ……mix the DNA sample 5ul with 2ul of gel loading dye and load in gel containing .7 percent agarose Carry out electrophoresis @ 90 volts for 1 hr After doing this total genomic DNA becomes visible on UV gel documentation system and take photo graph

PCR AMPLIFICATION : 

PCR AMPLIFICATION Primers set used TBR1;GAATATTAAACAATGCGCAG TBR2;CCATTTATTAGCTTTGTTGC Reaction Mixture 1x Taq Bffer,0.2 mM dNTP mixture,1.5 mM MgCl, Taq polymerase,4 uM of each primer,2 ul of extracted DNA,free deioinised water Amplification conditions: Step 1….. Denaturation @ 93 degree Celsius for 30 seconds Step 2…..Annealing @ 45 degree Celsius for 30 seconds step 3……Extension @ 72 degree Celsius for 1 minute Prior to cycling mixture is subjected to 93 degree Celsius for 3.00 min and at the end of cycling @72 degree Celsius for 5.00 min 30 cycles through step 1,2,3……….

DETECTION OF PCR AMPLIFIED TARGET DNA : 

DETECTION OF PCR AMPLIFIED TARGET DNA MATERIALS AND EQUIPMENTS Electrophoresis chamber, gel casting trays, sample comb,ethidium bromide, gel loading dye, micropipettes and tips to load dye samples, electrophoresis buffer TAE( Tris acetate EDTA),Polaroid camera,uv trans illuminator PREPARATION OF GEL To prepare 50 ml of 2.5 % agarose gel, take 1.25 g in Erlenmeyer flask and add 50 ml of water into it Heat the mixture in oven for 1-1.5 min till boils Molten gel solution is removed from oven using folded towel to hold neck Allow the gel to cool @ room temp. or in refrigerator before pouring

Slide 12: 

PREPARATION OF GEL TRAY AND GEL POURING Gel tray is prepared by sealing ends with tape Comb is placed in gel tray about 1 inch from one end of tray and position the comb vertically such that the teeth becomes about 1-2 mm above the surface of tray Before pouring add ethidium bromide to gel at this point to facilitate the visualization of DNA after electrophoresis Pour the gel solution into tray to a depth of about 5mm Allow the gel to solidify about 20-30 mins at room temperature or in a referigerator

PREPARATION AND LOADING OF SAMPLES : 

PREPARATION AND LOADING OF SAMPLES Take a small piece of parafilm, place it on bench near gel;8ul of 6x loading dye is spotted onto parafilm for each sample to be loaded on gel to increase the sample density 50ul sample is drawn into pipette and down onto a spot of loading dye to mix To load the sample firstly tape is removed from the ends of gel chamber Gel is placed in horizontal electrophoresis chamber with wells near –ve electrode ,gel chamber is filled with sufficient 1x TAE buffer ,such that level of liquid just covers the gel On data sheet is recorded where to load the dye samples 1 kb prepared ladder is loaded in one well and numbered dye samples are loaded in other wells

RUNNING THE GEL AND PHOTOGRAPHY : 

RUNNING THE GEL AND PHOTOGRAPHY Electrophoresis unit is connected to the power supply Power supply is turned on and start button is pressed to 90v Proper operation confirmed by checking the gas production(bubbles)due to water electrolysis Migration of DNA towards anode is noted, judged visually by monitoring migration of tracking/loading dye Gel is run until the tracking dye is approximately across 3/4 of the gel For photography light is turned off Gel is removed from chamber and placed on UV transilluminator to visualize DNA To confirm presence of DNA and to estimate its size, it is compared with a DNA ladder and photograph is taken with Polaroid camera

RESULTS : 

RESULTS

DISCUSSION : 

DISCUSSION Present study was designed to study the efficacy of PCR in comparison to the microscopic examination ,to standardize the modern molecular biological technique…..Trypanosomiasis Results indicate 5% suspected horses were positive with microscopic examination while 16% horses positive with PCR Results of present study confirmed the prevalence of Trypanosoma infection in Punjab Results clearly indicate that PCR is more sensitive than microscopic examination of blood for diagnosis of surra in horses PCR is more effective in diagnosis where parasitaemia is low ………….

DISCUSSION : 

DISCUSSION PCR can be used in other species like camels where the disease is more chronic and difficult to confirm by routine methods PCR not only sure diagnosis and treatment in individual animal but also detect animal reservoirs of infection, so help in eliminating threat to equine and camel when grazed together Using PCR is easy method of detecting various species of Trypanosomes

Slide 18: 

Any question ……………?????????????? Thanks for having listening and patience!!!!!!!!!!!