logging in or signing up PROTEIN SYNTHESIS-Arun M. Chilke achilke Download Post to : URL : Related Presentations : Share Add to Flag Embed Email Send to Blogs and Networks Add to Channel Uploaded from authorPOINT lite Insert YouTube videos in PowerPont slides with aS Desktop Copy embed code: (To copy code, click on the text box) Embed: URL: Thumbnail: WordPress Embed Customize Embed The presentation is successfully added In Your Favorites. Views: 41 Category: Science & Tech.. License: All Rights Reserved Like it (0) Dislike it (0) Added: December 31, 2011 This Presentation is Public Favorites: 0 Presentation Description This has been devoted to my students of B.Sc.Second year to all the students of life sciences all over the world. Comments Posting comment... Premium member Presentation Transcript PROTEIN SYNTHESIS: PROTEIN SYNTHESIS Dr. Arun M. Chilke Head, Department of Zoology Division of Toxicology and Biomonitoring Shree Shivaji Arts, Commerce and Science College, Rajura-442905 (India) E-mail: achilke.2011@rediffmail.com www.sscollegerajura.orgPowerPoint Presentation: Central Dogma Replication DNA PROTEIN RNA Transcription Reverse transcription Translation DNA replicate or duplicate to produce exact copy of itself in the presence of DNA dependent DNA polymerase ( Replicase ). However, transcribe in the presence of DNA dependent RNA polymerase to RNA and RNA translate into Polypeptide chain Of amino acids (Protein) and exhibit the one way information flow. In some viruses RNA in the presence of RNA dependent DNA polymerase ( Reverse Transcriptase) produces the DNA .Central Dogma makes you Understand how the genetic information flow: Central Dogma makes you Understand how the genetic information flow You are aquainted with the DNA, that contains several distinct or repetitive gene sequences. Characteristic of the DNA is: It has its own property, that, it can prepare exact copies of itself and this process is known as replication . Replicated product is exactly the replica of parent DNA strand, and hence, the resultant daughter DNAs are same to same. What we called xerox copy or dicto. Another property of DNA is that, it is capable of undergoing the transcription by which they produce complementary copy, we call m-RNA. This process is catalyse by Transcriptase or DNA-dependent RNA-Polymerase. Thus, m-RNA synthesized on the DNA-template is capable for translating the genetic message brought from DNA to sequence of amino acids in the polypeptide chain or protein, called translation . You would have understood, how the genetic information function from DNA to Protein mediated through m-RNA. This is the central dogma of protein synthesis.Mechanism of Protein synthesis: Mechanism of Protein synthesis There are two important phenomenon takes place during protein synthesis. They are: Transcription Translation Reverse transcription is also one of the important process by which RNA can synthesis DNA, and this process is catalyse by RNA-dependent-DNA-Polymerase ( Reverse Transcriptase ). Some viruses carry RNA as genetic material and this acellular organism when infect the host cell they also carry the above said enzyme. By utilising the whole synthetic machinery, this virus synthesizes the DNA from its own RNA and thence several copies of RNA and also the required proteins and consequently the viruses.TRANSCRIPTION: TRANSCRIPTION Transcription is the first process of protein synthesis. This activity requires some components of transcription machinery, they are: 1. Template DNA (Deoxyribose polynucleotide). 2. Activator components of Ribonucleoside triphosphate , i.e., ATP (Adenine ribose triphosphate):- A-p-p-p. GTP- (Guanine ribose triphosphate):- G-p-p-p. CTP (Cytosine ribose triphosphate):- C-p-p-p and UTP (Uracil ribose triphosphate):- U-p-p-p. 3. Divalent metal ions: Mg++ and Mn++ 4. RNA-Polymerase (Transcriptase)DNA-Template: DNA-Template ds-DNA ss-DNA Template DNA-strand m-RNA 1. Asymmetrical DNA transcription 2. Symmetrical DNA transcription Both the strands when synthesize the m-RNA is called symmetrical transcription ds-DNA ss-DNA m-RNA m-RNAPowerPoint Presentation: Activator components of Ribonucleoside triphosphate ATP (Adenine ribose triphosphate) CH2 H Guanine Ribose Triphosphate GTP (Guanine ribose triphosphate) CH2 H Adenine Ribose TriphosphatePowerPoint Presentation: CH2 H Cytosine Ribose Triphosphate CH2 H Guanine Ribose TriphosphateRNA Polymerase: RNA Polymerase RNA Polymerase is a spectacular enzyme, functioning in: Recognition of the promoter region Melting of DNA (Helicase + opisomerase) RNA Priming (Primase) RNA Polymerization Recognition of terminator sequence β’ β ω σ β’ β ω σ β’ β ω σ β’ β ω σPowerPoint Presentation: Initiation of Transcription Promoter region of DNA (Gene ) Recognition site Binding site Initiation site 5 TATpuATG 3 7-base pairs β’ β ω σ β’ β ω σ Diffusion of RNA polymerase from Recognition to binding site RNA polymerase finally binds to Initiation site to start the transcription Sigma factor β’ β ω σ RNA polymerasePowerPoint Presentation: ds-DNA Core enzyme Sigma factor Activated RNA-polymerase Template DNA stand Initiation of RNA synthesis on initiation site asymmetrical Transcription Symmetrical Transcription Protein d e a b c RNA Protein a b c RNA Transcription begins on both DNA strands Transcription begins on only one DNA strandsPowerPoint Presentation: m-RNA m-RNA Unwinding of DNA Dissociation of Sigma factor ρ m-RNA elongation 5 ’ 3 ’ Synthesis of RNA in the direction 5’ to 3’ on sense strand of DNA Elongation of RNA transcriptPowerPoint Presentation: Termination of RNA synthesis Transcription terminates by two methods- 1. By Poly-A sequence interaction with RNA polymerase and 2. By Rho-factor interaction. 1. Poly-A sequence interaction with RNA polymerase m-RNA Dissociation of both RNA and RNA polymerase m-RNA A A A A A A A U U U U U U U m-RNA transcript with poly U-tailPowerPoint Presentation: 2. Termination of Transcription by Rho-factor interaction. m-RNA Dissociation of both RNA and RNA polymerase Rho-factor m-RNAPowerPoint Presentation: TRANSLATIONPowerPoint Presentation: Activation of Amino acids Transfer of activated amino acids to t-RNA Initiation of Protein Synthesis Chain elongation Chain terminationPowerPoint Presentation: Activation of Amino acids E Amino acid ATP Amino acyl t-RNA synthetase + E + Aminoacyl Adnylate Pyrophosphate + Pyrophosphate AMPPowerPoint Presentation: Anticodon E + E + + AMP 2. Transfer of Activated Amino acids to t-RNAPowerPoint Presentation: IF-1 IF-2 IF-3 m-RNA 5’ 3’ AUGGCCACUACCACGCGCACCCAGUCAUUCAAGGCAACUUUUCACCAACGGGACGUUA 30-S Small ribosome subunit m-RNA 5’ 3’ IF-3 AUGGCCACUACCACGCGCACCCAGUCAUUCAAGGCAACUUUUCACCAACGGGACGUUA 4. Initiation of Protein SynthesisPowerPoint Presentation: Anticodon UAC m-RNA 5’ 3’ AUGGCCACUACCACGCGCACCCAGUCAUUCAAGGCAACUUUUCACCAACGGGACGUUA IF-3 IF-1 IF-2 50-S Anticodon t-RNA m-RNA 5’ 3’ IF-3 UAC IF-1 IF-2 N-formylmethionine CGG AUGGCCACUACCACGCGCACCCAGUCAUUCAAGGCAACUUUUCACCAACGGGACGUUAPowerPoint Presentation: CGG UAC m-RNA 5’ 3’ IF-3 IF-1 IF-2 AUGGCCACUACCACGCGCACCCAGUCAUUCAAGGCAACUUUUCACCAACGGGACGUUA 5’ 3’ UAC IF-3 IF-1 IF-2 CGG A P E AUGGCCACUACCACGCGCACCCAGUCAUUCAAGGCAACUUUUCACCAACGGGACGUUA 5. Elongation of polypeptide chainPowerPoint Presentation: AUGGCCACUACCACGCGCACCCAGUCAUUCAAGGCAACUUUUCACCAACGGGACGUUA CGG UGA AUGGCCACUACCACGCGCACCCAGUCAUUCAAGGCAACUUUUCACCAACGGGACGUUA CGG UGAPowerPoint Presentation: CCC UUG AUGGCCACUACCACGCGCACCCAGUCAUUCAAGGCAACUUUUCACCAACGGGACGUUA TF-1 AUGGCCACUACCACGCGCACCCAGUCAUUCAAGGCAACUUUUCACCAACGGGACGUUA UGG UGA CGG 6. Termination protein synthesisPowerPoint Presentation: UUG AUGGCCACUACCACGCGCACCCAGUCAUUCAAGGCAACUUUUCACCAACGGGACGUUA TF-1PowerPoint Presentation: Thank you ! Kindly suggest the change on given email You do not have the permission to view this presentation. In order to view it, please contact the author of the presentation.
PROTEIN SYNTHESIS-Arun M. Chilke achilke Download Post to : URL : Related Presentations : Share Add to Flag Embed Email Send to Blogs and Networks Add to Channel Uploaded from authorPOINT lite Insert YouTube videos in PowerPont slides with aS Desktop Copy embed code: (To copy code, click on the text box) Embed: URL: Thumbnail: WordPress Embed Customize Embed The presentation is successfully added In Your Favorites. Views: 41 Category: Science & Tech.. License: All Rights Reserved Like it (0) Dislike it (0) Added: December 31, 2011 This Presentation is Public Favorites: 0 Presentation Description This has been devoted to my students of B.Sc.Second year to all the students of life sciences all over the world. Comments Posting comment... Premium member Presentation Transcript PROTEIN SYNTHESIS: PROTEIN SYNTHESIS Dr. Arun M. Chilke Head, Department of Zoology Division of Toxicology and Biomonitoring Shree Shivaji Arts, Commerce and Science College, Rajura-442905 (India) E-mail: achilke.2011@rediffmail.com www.sscollegerajura.orgPowerPoint Presentation: Central Dogma Replication DNA PROTEIN RNA Transcription Reverse transcription Translation DNA replicate or duplicate to produce exact copy of itself in the presence of DNA dependent DNA polymerase ( Replicase ). However, transcribe in the presence of DNA dependent RNA polymerase to RNA and RNA translate into Polypeptide chain Of amino acids (Protein) and exhibit the one way information flow. In some viruses RNA in the presence of RNA dependent DNA polymerase ( Reverse Transcriptase) produces the DNA .Central Dogma makes you Understand how the genetic information flow: Central Dogma makes you Understand how the genetic information flow You are aquainted with the DNA, that contains several distinct or repetitive gene sequences. Characteristic of the DNA is: It has its own property, that, it can prepare exact copies of itself and this process is known as replication . Replicated product is exactly the replica of parent DNA strand, and hence, the resultant daughter DNAs are same to same. What we called xerox copy or dicto. Another property of DNA is that, it is capable of undergoing the transcription by which they produce complementary copy, we call m-RNA. This process is catalyse by Transcriptase or DNA-dependent RNA-Polymerase. Thus, m-RNA synthesized on the DNA-template is capable for translating the genetic message brought from DNA to sequence of amino acids in the polypeptide chain or protein, called translation . You would have understood, how the genetic information function from DNA to Protein mediated through m-RNA. This is the central dogma of protein synthesis.Mechanism of Protein synthesis: Mechanism of Protein synthesis There are two important phenomenon takes place during protein synthesis. They are: Transcription Translation Reverse transcription is also one of the important process by which RNA can synthesis DNA, and this process is catalyse by RNA-dependent-DNA-Polymerase ( Reverse Transcriptase ). Some viruses carry RNA as genetic material and this acellular organism when infect the host cell they also carry the above said enzyme. By utilising the whole synthetic machinery, this virus synthesizes the DNA from its own RNA and thence several copies of RNA and also the required proteins and consequently the viruses.TRANSCRIPTION: TRANSCRIPTION Transcription is the first process of protein synthesis. This activity requires some components of transcription machinery, they are: 1. Template DNA (Deoxyribose polynucleotide). 2. Activator components of Ribonucleoside triphosphate , i.e., ATP (Adenine ribose triphosphate):- A-p-p-p. GTP- (Guanine ribose triphosphate):- G-p-p-p. CTP (Cytosine ribose triphosphate):- C-p-p-p and UTP (Uracil ribose triphosphate):- U-p-p-p. 3. Divalent metal ions: Mg++ and Mn++ 4. RNA-Polymerase (Transcriptase)DNA-Template: DNA-Template ds-DNA ss-DNA Template DNA-strand m-RNA 1. Asymmetrical DNA transcription 2. Symmetrical DNA transcription Both the strands when synthesize the m-RNA is called symmetrical transcription ds-DNA ss-DNA m-RNA m-RNAPowerPoint Presentation: Activator components of Ribonucleoside triphosphate ATP (Adenine ribose triphosphate) CH2 H Guanine Ribose Triphosphate GTP (Guanine ribose triphosphate) CH2 H Adenine Ribose TriphosphatePowerPoint Presentation: CH2 H Cytosine Ribose Triphosphate CH2 H Guanine Ribose TriphosphateRNA Polymerase: RNA Polymerase RNA Polymerase is a spectacular enzyme, functioning in: Recognition of the promoter region Melting of DNA (Helicase + opisomerase) RNA Priming (Primase) RNA Polymerization Recognition of terminator sequence β’ β ω σ β’ β ω σ β’ β ω σ β’ β ω σPowerPoint Presentation: Initiation of Transcription Promoter region of DNA (Gene ) Recognition site Binding site Initiation site 5 TATpuATG 3 7-base pairs β’ β ω σ β’ β ω σ Diffusion of RNA polymerase from Recognition to binding site RNA polymerase finally binds to Initiation site to start the transcription Sigma factor β’ β ω σ RNA polymerasePowerPoint Presentation: ds-DNA Core enzyme Sigma factor Activated RNA-polymerase Template DNA stand Initiation of RNA synthesis on initiation site asymmetrical Transcription Symmetrical Transcription Protein d e a b c RNA Protein a b c RNA Transcription begins on both DNA strands Transcription begins on only one DNA strandsPowerPoint Presentation: m-RNA m-RNA Unwinding of DNA Dissociation of Sigma factor ρ m-RNA elongation 5 ’ 3 ’ Synthesis of RNA in the direction 5’ to 3’ on sense strand of DNA Elongation of RNA transcriptPowerPoint Presentation: Termination of RNA synthesis Transcription terminates by two methods- 1. By Poly-A sequence interaction with RNA polymerase and 2. By Rho-factor interaction. 1. Poly-A sequence interaction with RNA polymerase m-RNA Dissociation of both RNA and RNA polymerase m-RNA A A A A A A A U U U U U U U m-RNA transcript with poly U-tailPowerPoint Presentation: 2. Termination of Transcription by Rho-factor interaction. m-RNA Dissociation of both RNA and RNA polymerase Rho-factor m-RNAPowerPoint Presentation: TRANSLATIONPowerPoint Presentation: Activation of Amino acids Transfer of activated amino acids to t-RNA Initiation of Protein Synthesis Chain elongation Chain terminationPowerPoint Presentation: Activation of Amino acids E Amino acid ATP Amino acyl t-RNA synthetase + E + Aminoacyl Adnylate Pyrophosphate + Pyrophosphate AMPPowerPoint Presentation: Anticodon E + E + + AMP 2. Transfer of Activated Amino acids to t-RNAPowerPoint Presentation: IF-1 IF-2 IF-3 m-RNA 5’ 3’ AUGGCCACUACCACGCGCACCCAGUCAUUCAAGGCAACUUUUCACCAACGGGACGUUA 30-S Small ribosome subunit m-RNA 5’ 3’ IF-3 AUGGCCACUACCACGCGCACCCAGUCAUUCAAGGCAACUUUUCACCAACGGGACGUUA 4. Initiation of Protein SynthesisPowerPoint Presentation: Anticodon UAC m-RNA 5’ 3’ AUGGCCACUACCACGCGCACCCAGUCAUUCAAGGCAACUUUUCACCAACGGGACGUUA IF-3 IF-1 IF-2 50-S Anticodon t-RNA m-RNA 5’ 3’ IF-3 UAC IF-1 IF-2 N-formylmethionine CGG AUGGCCACUACCACGCGCACCCAGUCAUUCAAGGCAACUUUUCACCAACGGGACGUUAPowerPoint Presentation: CGG UAC m-RNA 5’ 3’ IF-3 IF-1 IF-2 AUGGCCACUACCACGCGCACCCAGUCAUUCAAGGCAACUUUUCACCAACGGGACGUUA 5’ 3’ UAC IF-3 IF-1 IF-2 CGG A P E AUGGCCACUACCACGCGCACCCAGUCAUUCAAGGCAACUUUUCACCAACGGGACGUUA 5. Elongation of polypeptide chainPowerPoint Presentation: AUGGCCACUACCACGCGCACCCAGUCAUUCAAGGCAACUUUUCACCAACGGGACGUUA CGG UGA AUGGCCACUACCACGCGCACCCAGUCAUUCAAGGCAACUUUUCACCAACGGGACGUUA CGG UGAPowerPoint Presentation: CCC UUG AUGGCCACUACCACGCGCACCCAGUCAUUCAAGGCAACUUUUCACCAACGGGACGUUA TF-1 AUGGCCACUACCACGCGCACCCAGUCAUUCAAGGCAACUUUUCACCAACGGGACGUUA UGG UGA CGG 6. Termination protein synthesisPowerPoint Presentation: UUG AUGGCCACUACCACGCGCACCCAGUCAUUCAAGGCAACUUUUCACCAACGGGACGUUA TF-1PowerPoint Presentation: Thank you ! Kindly suggest the change on given email