logging in or signing up 1 Johnson Waldarrama Download Post to : URL : Related Presentations : Share Add to Flag Embed Email Send to Blogs and Networks Add to Channel Uploaded from authorPOINTLite Insert YouTube videos in PowerPont slides with aS Desktop Copy embed code: (To copy code, click on the text box) Embed: URL: Thumbnail: WordPress Embed Customize Embed The presentation is successfully added In Your Favorites. Views: 158 Category: Entertainment License: All Rights Reserved Like it (0) Dislike it (0) Added: November 23, 2007 This Presentation is Public Favorites: 0 Presentation Description No description available. Comments Posting comment... Premium member Presentation Transcript Epidemiology of Rabies in Southeast Europe: Epidemiology of Rabies in Southeast Europe Nicholas Johnson Rabies and Wildlife Zoonoses Group WHO Collaborating Centre for the Characterization of Rabies and Rabies-Related Viruses Introduction: Introduction Rabies is endemic within many countries of south east Europe The fox is the principal reservoir species but dog rabies cases still reported Few epidemiological studies reported from the region Identify factors that contribute to epidemiology Lack of knowledge hampers vaccination programmes Southeast Europe (the Balkans): Southeast Europe (the Balkans)The Balkan Peninsular: The Balkan Peninsular Turkey Bulgaria Romania Bosnia and Herzegovina Ukraine Czech Republic Greece Poland Russia Slovakia Hungary Austria Croatia Slovenia Albania Serbia MacCohort Details: Cohort Details Isolate details: Isolate detailsRegion of the Genome: Region of the Genome 327 nucleotides TTATCGTGGATCAATATGAGTACAAGTACCCTGCCATCAAAGATTTGAAAAAGCCCTGTATAACTCTAGGAAAGGCTCCC GATTTAAATAAAGCATACAAGTCAGTTTTATCATGCATGAGCGCCGCCAAACTTGATCCTGACGATGTATGTTCCTATTT GGCGGCGGCAATGCAGTTTTTTGAGGGGACATGTCCGGAAGACTGGACCAGCTATGGAATCGTGATTGCACGAAAAGGAG ATAAGATCACCCCAGGTTCTCTGGTGGAGATAAAACGTACTGATGTAGAAGGGAATTGGGCTCTGACAGGAGGCATGGAA CTGACAAGAGACCCCAC N P M G LPhylogenetic analysis of RABV sequences from Southeastern Europe: Phylogenetic analysis of RABV sequences from Southeastern Europe SAD B19 Pasteur Bosnia-Herzegovina Western Turkey Romania / Russia Romania Bulgaria Eastern TurkeyPhylogenetic tree of Eastern European Isolates: Phylogenetic tree of Eastern European Isolates Eastern Romania / RussiaRomania: Romania Bulgaria: Bulgaria Targovishte Dobrich Lovech Montana Pleven Lovech Former Yugoslavia Vidin MontanaBosnia-Herzegovina: Bosnia-Herzegovina Bosnia-Herzegovina Hungary Conclusions: Conclusions Most isolates fall into the East European group of viruses Geography dominates isolate clustering Topography may play a significant role in preventing spread of fox-rabies The Danube appears to block movement between Romania and Bulgaria Such factors could assist in future vaccination campaignsAcknowledgements: Acknowledgements Co-Authors Veterinary Laboratories Agency (UK) AR Fooks FLI-Wusterhausen (Germany) T Muller, C Freuling IDT (Germany) A Vos Etlik CVRI (Turkey) O Aylan H Un Natl. Diag. & Res Vet Inst (Bulgaria) R Valtchovski Inst. Diag. & Animal Health (Romania) M Turcitu F Dumistrescu V Vlad Univ. Sarajevo (Bosnia-Hervegovina) R Velic Vet. Inst. Of Republika of Srpska V Sandrac Funding Defra (UK) You do not have the permission to view this presentation. In order to view it, please contact the author of the presentation.
1 Johnson Waldarrama Download Post to : URL : Related Presentations : Share Add to Flag Embed Email Send to Blogs and Networks Add to Channel Uploaded from authorPOINTLite Insert YouTube videos in PowerPont slides with aS Desktop Copy embed code: (To copy code, click on the text box) Embed: URL: Thumbnail: WordPress Embed Customize Embed The presentation is successfully added In Your Favorites. Views: 158 Category: Entertainment License: All Rights Reserved Like it (0) Dislike it (0) Added: November 23, 2007 This Presentation is Public Favorites: 0 Presentation Description No description available. Comments Posting comment... Premium member Presentation Transcript Epidemiology of Rabies in Southeast Europe: Epidemiology of Rabies in Southeast Europe Nicholas Johnson Rabies and Wildlife Zoonoses Group WHO Collaborating Centre for the Characterization of Rabies and Rabies-Related Viruses Introduction: Introduction Rabies is endemic within many countries of south east Europe The fox is the principal reservoir species but dog rabies cases still reported Few epidemiological studies reported from the region Identify factors that contribute to epidemiology Lack of knowledge hampers vaccination programmes Southeast Europe (the Balkans): Southeast Europe (the Balkans)The Balkan Peninsular: The Balkan Peninsular Turkey Bulgaria Romania Bosnia and Herzegovina Ukraine Czech Republic Greece Poland Russia Slovakia Hungary Austria Croatia Slovenia Albania Serbia MacCohort Details: Cohort Details Isolate details: Isolate detailsRegion of the Genome: Region of the Genome 327 nucleotides TTATCGTGGATCAATATGAGTACAAGTACCCTGCCATCAAAGATTTGAAAAAGCCCTGTATAACTCTAGGAAAGGCTCCC GATTTAAATAAAGCATACAAGTCAGTTTTATCATGCATGAGCGCCGCCAAACTTGATCCTGACGATGTATGTTCCTATTT GGCGGCGGCAATGCAGTTTTTTGAGGGGACATGTCCGGAAGACTGGACCAGCTATGGAATCGTGATTGCACGAAAAGGAG ATAAGATCACCCCAGGTTCTCTGGTGGAGATAAAACGTACTGATGTAGAAGGGAATTGGGCTCTGACAGGAGGCATGGAA CTGACAAGAGACCCCAC N P M G LPhylogenetic analysis of RABV sequences from Southeastern Europe: Phylogenetic analysis of RABV sequences from Southeastern Europe SAD B19 Pasteur Bosnia-Herzegovina Western Turkey Romania / Russia Romania Bulgaria Eastern TurkeyPhylogenetic tree of Eastern European Isolates: Phylogenetic tree of Eastern European Isolates Eastern Romania / RussiaRomania: Romania Bulgaria: Bulgaria Targovishte Dobrich Lovech Montana Pleven Lovech Former Yugoslavia Vidin MontanaBosnia-Herzegovina: Bosnia-Herzegovina Bosnia-Herzegovina Hungary Conclusions: Conclusions Most isolates fall into the East European group of viruses Geography dominates isolate clustering Topography may play a significant role in preventing spread of fox-rabies The Danube appears to block movement between Romania and Bulgaria Such factors could assist in future vaccination campaignsAcknowledgements: Acknowledgements Co-Authors Veterinary Laboratories Agency (UK) AR Fooks FLI-Wusterhausen (Germany) T Muller, C Freuling IDT (Germany) A Vos Etlik CVRI (Turkey) O Aylan H Un Natl. Diag. & Res Vet Inst (Bulgaria) R Valtchovski Inst. Diag. & Animal Health (Romania) M Turcitu F Dumistrescu V Vlad Univ. Sarajevo (Bosnia-Hervegovina) R Velic Vet. Inst. Of Republika of Srpska V Sandrac Funding Defra (UK)