Use of 2T TA PCR in HPV16 diagnostic model

Views:
 
Category: Education
     
 

Presentation Description

No description available.

Comments

Presentation Transcript

Slide1: 

Use of 2T-TA PCR in HPV-16 diagnostic model

Slide2: 

Experiment in HPV-16 model to establish: Effect of extended primers and initial high temperature cycling on sensitivity of standard reaction Detection capabilities of 2T-TA Experimental outline: 1. Amplification of amplicon / target with standard & 2T-TA primers 2. Detection of target in genomic DNA background 3. Detection of amplicon in genomic DNA background 4. Detection of amplicon & target in genomic DNA background HPV-16 2T-TA: outline

HPV-16 2T-TA: background: 

HPV-16 2T-TA: background Standard F primer: ATGAAATAGATGGTCCA Standard R primer: GCAACAAAAGGTTACAA 2T-TA F primer: GCACGCCGAGAGAAGAGACATGAAATAGATGGTCCA 2T-TA R primer: GCACGTCCGCTGTGACTGTCGCAACAAAAGGTTACAA HPV16 target DNA mimic (92bp): AGCTCAGAGGAGGAGGATGAAATAGATGGTCCAGCTGGACAAGCAGAACCGGACAGAGC CCATTACAATATTGTAACCTTTTGTTGCAAGTG Human genomic DNA 50ng/ml (Promega Corporation) LightCycler 1.2 (Roche Applied Sciences) FastStart SYBR Green I Master Mix (Roche Applied Sciences)

HPV-16 2T-TA: PCR product Tm and size: 

HPV-16 2T-TA: PCR product Tm and size 2T-TA primer product Standard primer product 34bp 67bp 110bp Standard product 2T-TA product Size marker 5% agarose gel Expected sizes of PCR products: Standard primers 71bp 2T-TA primers 110bp

HPV-16 2T-TA :Amplification of target and amplicon DNA with standard and 2T-TA primers: 

HPV-16 2T-TA :Amplification of target and amplicon DNA with standard and 2T-TA primers

HPV-16 2T-TA: Detection of amplicon with 2T-TA primers and 72°C annealing: 

HPV-16 2T-TA: Detection of amplicon with 2T-TA primers and 72°C annealing Dilution series: 108 to 102 copies amplicon DNA NTC 95°C 10 min x 1 95°C 10 sec 72°C 20 sec x40 Cycling parameters:

HPV-16 2T-TA: Detection of HPV-16 target DNA in background of human genomic DNA: 

HPV-16 2T-TA: Detection of HPV-16 target DNA in background of human genomic DNA Increased efficiency with extended primers

HPV-16 2T-TA: Detection of amplicon in background of human genomic DNA: 

HPV-16 2T-TA: Detection of amplicon in background of human genomic DNA NTC Dilution series: 105 to 101 copies amplicon DNA 95°C 10 min x 1 95°C 10 sec 70°C 0 sec x40 77°C 25sec Cycling parameters:

HPV-16 2T-TA: Detection of single copy amplicon: 

HPV-16 2T-TA: Detection of single copy amplicon 95°C 10 min x 1 95°C 10 sec 70°C 0 sec x45 77°C 25sec 95 °C 10 sec 47°C 0 sec x40 77°C 25sec Cycling parameters: 70°C annealing 47°C annealing Amplicon only 103 102 101 100 100 amplicon only No amplification was seen at dilution of 10-1 copies amplicon DNA Fraction of 100 amplicon samples detected to contain amplicon was consistent with distribution of single copies. Conclusion is that 2T-TA method detected single copy amplicon

HPV-16 2T-TA: Detection of amplicon in the presence of target DNA: 

HPV-16 2T-TA: Detection of amplicon in the presence of target DNA 95°C 10 min x 1 95°C 10 sec 70°C 0 sec x45 77°C 25sec 95 °C 10 sec 47°C 0 sec x40 77°C 25sec Cycling parameters: 70°C annealing 47°C annealing Amplicon Target 103 106 102 106 101 106 106 target only

HPV-16 2T-TA: Detection of amplicon in mixtures of amplicon and target : 

HPV-16 2T-TA: Detection of amplicon in mixtures of amplicon and target 95°C 10 min x 1 95°C 10 sec 70°C 0 sec x45 77°C 25sec 95 °C 10 sec 47°C 0 sec x40 77°C 25sec Cycling parameters: Crossing points are the same for varying levels of target Detection of single copy amplicon

HPV-16 2T-TA: Crossing point for detection of target is not altered by initial high temperature cycles : 

HPV-16 2T-TA: Crossing point for detection of target is not altered by initial high temperature cycles

HPV-16 2T-TA: Summary: 

HPV-16 2T-TA: Summary 2T-TA PCR can detect single copy of amplicon DNA in background of human genomic DNA Crossing point for target DNA was not affected by high temperature cycles in 2T-TA PCR, suggesting optimised 2T-TA PCR will have equivalent sensitivity to standard PCR Experiment needs to be repeated in the context of further optimised clinical diagnostic model

Slide14: 

Magdalen Centre The Oxford Science Park Oxford SX4 4GA adam.levy@amplion.co.uk direct dial: +44 (0) 7771 802713

authorStream Live Help