875 PERL 06 mini

Uploaded from authorPOINTLite
Views:
 
Category: Entertainment
     
 

Presentation Description

No description available.

Comments

By: arivu (30 month(s) ago)

can u send this ppt to my mail id: arivu.kkarasan@yahoo.in

By: ksubbaraju (37 month(s) ago)

please can u send this PPT ksubbaraju08@gmail.com

Presentation Transcript

Slide1: 

Introduction to PERL Genetics 875 10/19/06 PERL is a language that is easy to use and was designed to do certain tasks (like reading, writing, moving text & sequences) very well Advantages of PERL: - it’s intuitive - it’s easy to get started … you don’t need to know everything initially - it’s very good at reading and manipulating files, sequences, text - there is usually >1 way to accomplish a task Disadvantages of PERL: Perl programs are different from other programs, in that the program you write is “run” by another program which interprets your code (this interpreter is actually called perl … your programs will be run by the perl interpreter). Because of this, your code is one level removed from the actual computer … Therefore, perl programs are slower than other languages (like C, C++). Thus, perl is not used so much for functions that require heavy computation.

Slide2: 

A great way to learn PERL: http://www.oreilly.com/catalog/lperl3/ “Learning Perl” Also, some great online resources: http://www.perl.com/ A short PERL tutorial http://archive.ncsa.uiuc.edu/General/Training/PerlIntro/ And lots of other help on the web ….

Slide3: 

Like any language, programming languages have structure A book has words, sentences, paragraphs, chapters, and punctuation linking them all together ENGLISH PERL Noun Scalar, variable Verb Function, command Phrase Statement, expression Paragraph Loop Chapter Subroutines, packages, modules

Slide4: 

A variable is a container that can hold information that has the potential to vary Variables can be singular, in which case they are identified by a “$” in front of the variable name eg) $x $File1 $StudentName They can be a number, letter (called a “character” in perl), string of numbers, or string of letters … just remember that whatever it is, it is considered a single item. eg) $x = 5 $motif = “GATTAC” $StudentName = “Rutabega” Variables can be plural and those come in different forms: Arrays and Hashes

Slide5: 

Arrays are a list of single variables An array is a container that holds a list of separate, single variables in a specific order An array is denoted by a @ in front of its name Eg) @StudentNames = “Caligula”, “Randolph”, “Imelda” “Caligula” is stored in the first ‘cell’ of the array, which is the “0” cell “Randoph” is stored in the second ‘cell’ of the array, which is the “1” cell “Imelda” is stored in the third ‘cell’ of the array, which is the “2” cell ** Note that in programming languages, you always start counting at “0” instead of at “1” Position in array: 0 1 2 Value stored at that position: Caligula Randolph Imelda

Slide6: 

Arrays are a list of single variables An array is a container that holds a list of separate, single variables in a specific order An array is denoted by a @ in front of its name Eg) @StudentNames = ( “Caligula”, “Randoph”, “Imelda” ) Position in array: 0 1 2 Value stored at that position: Caligula Randoph Imelda You can ‘call’ a specific cell (which, remember, is a singular variable identified by $): $StudentNames[0] = “Caligula” $StudentNames[1] = “Randolph” This $ tells perl that you want a singular variable These brackets tell perl that you are looking at a single cell in an array Between these two parts of the name, perl knows this is a cell of an array

Slide7: 

Exercise 0: Write your first perl program! We will start by creating a simple perl program where you will print a string to the screen. A few things about writing perl programs: -- The first few lines of the program (which you’ll write in a .pl text file) will contain information for the computer about how to run the program -- In order for the perl interpreter to understand your code, you must use the right syntax. Like in English, each phrase must have an obvious start and stop point. The most common punctuation in perl is “;” which acts like a period does in English. A statement begins after the “;” from the previous statement, and ends at the next “;” There will be other kinds of punctuation which define statements/items, like (….) {……} “…..” and we’ll get to these in a bit. One useful punctuation is # which means “Don’t read this line of the file” – it is useful because you can type in notes to yourself (“comments”) that aren’t part of the code.

Slide8: 

Exercise 0: Write your first perl program! Open the terminal on your computer and go to the desktop use the unix command “cd” to change directories (type everything written in brown) cd Desktop We will use the text editor “emacs” to create and write your file emacs FirstProgram.pl This should open a blank file, since you just created it Type this in the first line of your .pl file: #!/usr/bin/perl This is a special magic command that tells the computer to use the perl interpreter to read and execute your program. We will use a special mode of perl called “strict.” To do that, type this on the second line of your .pl file: use strict; Save your file using the emacs command, “Ctrl x Ctrl s” (ie, hold down Ctrl key and hit x then s) You are now ready to start writing your own code!

Slide9: 

Exercise 0: Write your first perl program! 6. Print a sentence to the screen using the built-in perl “print” function print “Hello. Welcome to your first perl program \n”; The default for the print function is to print to the screen from where you ran the program. We will learn later how you can print to a file. Note the “\n” at the end of this print statement. “\n” stands for “new-line character” This “\n” adds a ‘return’ to the end of your statement to end the line You’ve now written your first perl program. To run your program, open another terminal window. You will call the perl interpreter and then feed it your program file name perl FirstProgram.pl 7. Save your file using the emacs command, “Ctrl x Ctrl s” (ie, hold down Cntrl key and hit x then s) You will either see your sentenced on the screen, or you will get some kind of error …

Slide10: 

#!usr/bin/perl use strict; print “Hello. Welcome to your first perl program \n”;

Slide11: 

Exercise 1: Modify your first perl program We will create and define a string variable and an array. You will add code to your existing program. Make a variable called Name: my $Name; *since we are using “strict” mode, you must define a variable before you use it … for whatever reason, you do that by typing “my” in front of the variable, only when you create the variable (ie. The first time you ever type it) Define the variable $Name to be your own name: $Name = “Audrey”; Create an array called FavoriteHolidays my @FavoriteHolidays; Define the array as your top 3 favorite holidays, exactly as below: @FavoriteHolidays = (“Halloween”, “Christmas” , “Arbor Day”);

Slide12: 

Exercise 1: Modify your first perl program Print the variables you just defined to the screen using the built-in perl “print” function print “The top favorite holiday for $Name is $FavoriteHolidays[0]\n”; Save your program by typing Ctrl x Ctrl s 12. Exit the program by typing Ctrl x Ctrl c You will either see your name and holiday, or you will get some kind of error … To run your program, open another terminal window. You will call the perl interpreter and then feed it your program file perl FirstProgram.pl We will create and define a string variable and an array.

Slide13: 

#!usr/bin/perl use strict; print “Hello. Welcome to your first perl program \n”; my $Name; $Name = "Audrey"; my @FavoriteHolidays; @FavoriteHolidays = ("Halloween", "Christmas", "Arbor Day"); print "The top favorite holiday for $Name is $FavoriteHolidays[0]\n";

Slide14: 

Hashes are fancy containers for single variables Whereas an array indexes variables by their position in the list: A hash indexes one variable by another (known as a ‘key’): for example, Name and hometown Key in hash: Caligula Randolph Imelda Value stored with that key: Rome Berlin Manila A hash is denoted by %. To call the individual values contained in the hash, you need the key name my %HomeTowns; $HomeTowns{ “Caligula”} = “Rome” Position in array: 0 1 2 Value stored at that position: Caligula Randoph Imelda $ for calling single variable curly brackets tell you it’s a hash

Slide15: 

Exercise 2: Create and use a Hash 1. You will add code to your existing program. Make a hash called HolidayMonth: my %HolidayMonth; Define the Hash, with the key = holiday and the stored value = the month $HolidayMonth{ “Halloween” } = “October”; $HolidayMonth{ “Christmas” } = “December”; $HolidayMonth{ “Arbor Day” } = “April”; 3. Print the month of the top holiday print “The top favorite holiday for $Name is $FavoriteHolidays[0] in $HolidayMonth{Halloween} \n”;

Slide16: 

#!usr/bin/perl use strict; print “Hello. Welcome to your first perl program \n”; my $Name; $Name = "Audrey"; my @FavoriteHolidays; @FavoriteHolidays = ("Halloween", "Christmas", "Arbor Day"); my %HolidayMonth; $HolidayMonth{“Halloween”} = “October”; $HolidayMonth{“Christmas”} = “December”; $HolidayMonth{“Arbor Day”} = “April”; print “The top favorite holiday for $Name is $FavoriteHolidays[0] in $HolidayMonth{Halloween} \n”;

Slide17: 

Perl has a lot of built in functions and ‘operators’ + means add $x + 5; is 7 means subtract $y – 3; is 0 * means multiply $x * 3; is 6 / means divide ($x*3)/2 is 3 ++ means increase by 1 $y++; is 4 = assignment operator (set a variable to = something) = = is to evaluate equality There are different operators for strings: $x = 123 $y = 456 $z = 3 . means concatenate two strings $x . $y; is 123456 x means replicate a string $z x 4; is 3333 eq evaluates string equality These things work on numbers. $x = 2; $y = 3;

Slide18: 

Conditional statement Often you only want to do something if a certain condition is true. This is a case for if/unless/else statements If $x is equal to 5, then do something translates to if ($x = = 5) { something …. }

Slide19: 

Conditional statement Often you only want to do something if a certain condition is true. This is a case for if/unless/else statements If $x is equal to 5, then do something translates to if ($x = = 5) { something …. } Parentheses define the start and stop of the condition = = means if $x is exactly equal to 5 If you type if ($x = 5) it will reset $x to be 5 and the statement is automatically true … this is because to perl, = means “set this variable equal to …” Curly brackets define what to do if the conditional statement is true.

Slide20: 

Conditional statement Can also use if-then-else statements: if ($x = = 5) { something …. }else { do something different … } if ($x = = 5) { something …. }elsif ($x<10) { do something different … } OR The program will evaluate the statement in ( …) – if true, it will do what’s in { ..} if false it will SKIP what’s in { … } and resume on the line after that section.

Slide21: 

Conditional statement The ‘while’ statement is useful: do something while (some condition is true). my $count = 0; while ($count < 100) { do some function … $count++; ) The ‘while’ statement turns out to be very useful for reading in files … Remember that ++ is the “increment by one” operator. So each time you go through the loop, $count increases by one. If you forget to increase count and it stays at 0, you will be in an infinite loop. Note that a while statement is a kind of loop …

Slide22: 

Repeating actions: Loops Very often, want to repeat the same function many times (often on different variables). For example: -- open a file of microarray data -- read in each line of the file -- divide the 3rd cell of data by some constant -- save the file for (my $i = 0; $i<10; $i++) { do something … } There are 3 components of a “for loop”:

Slide23: 

Repeating actions: Loops Very often, want to repeat the same function many times (often on different variables). For example: -- open a file of microarray data -- read in each line of the file -- divide the 3rd cell of data by some constant -- save the file for (my $i = 0; $i<10; $i++) { do something … } create a new variable to use as a counter usually start that counter off at 0 do whatever as long as $i < 10 after each loop, increment $I by one (using the ++ operator)

Slide24: 

Repeating actions: Loops Very often, want to repeat the same function many times (often on different variables). For example: -- open a file of microarray data -- read in each line of the file -- divide the 3rd cell of data by some constant -- save the file for (my $i = 0; $i<10; $i++) { do something … } create a new variable to use as a counter usually start that counter off at 0 do whatever as long as $i < 10 after each loop, increment $I by one (using the ++ operator) An important concept: scope – if you create a variable inside a loop, it is a “local” variable = it only exists while you’re in the loop (in this case, $i is a local variable). If you want a variable that is “global,” ie. it exists for the duration of the program, be sure to declare it outside of any loops.

Slide25: 

#!usr/bin/perl use strict; print “Hello. Welcome to your first perl program \n”; my $Name; $Name = "Audrey"; my @FavoriteHolidays; @FavoriteHolidays = ("Halloween", "Christmas", "Arbor Day"); my %HolidayMonth; $HolidayMonth{“Halloween”} = “October”; $HolidayMonth{“Christmas”} = “December”; $HolidayMonth{“Arbor Day”} = “April”; for (my $i=0; $i<3; $i++) { print “Number $i favorite holiday for $Name is $FavoriteHolidays[$i]; } Exercise 3: using loops

Slide26: 

A note about loops, spaces, and punctuation: Having the correct punctuation is critical in perl. -- Sometimes if you have the wrong punctuation, perl will choke and give you an error -- Other times it will NOT choke and may look like it’s working, but it’s actually not doing what you intended. Spaces: perl reads anything without a space as one ‘word’. If you are trying to add two variables together, you must allow perl to read the separate items in your statement: $x=$y.$z #(perl will read this as one ‘word’ and probably choke) $x = $y . $z #(eg. In order to understand the ‘.’ operator, it should be flanked by spaces eg) if ($x < $y) {… } # if there is no space between ‘if’ and ‘(‘ perl can’t read it. however) chomp( $whatever ); # here chomp is a function and the ( ..) actually are # part of that function – so here you can’t have a space # between chomp and (). it takes awhile to get the hang of when spaces don’t affect things and when they do. Curly brackets in loops: Always think carefully about the structure of your program. Sometimes you want to finish one loop before beginning the next one, other times you need nested loops … it depends on what you’re trying to do – but if you set it up incorrectly, your program may not be functioning as you had intended (an example of this later on). One thing that helps a lot in looking at your own code is using tabs in your writing: every time you start a new loop, indent each line of code within the loop with a tab … note how I have my code structured – it really helps to see where the loops are and which brackets pair up.

Slide27: 

File Handling: talking to the outside world can open existing files to read in data and can create new files to write to using “open” open (HANDLE, “FileName.txt”); shorthand file handle actual file name … default is read-only file

Slide28: 

File Handling: talking to the outside world can open existing files to read in data and can create new files to write to using “open” open (HANDLE, “>FileName.txt”) shorthand file handle actual file name this “>” means it’s a writable file You can also use this function to create a new file and write to it: open (SF, “>SaveFile.txt”); print SF “$x”; # instead of printing to the screen, you will now print to the file.

Slide29: 

#!usr/bin/perl use strict; print “Hello. Welcome to your first perl program \n”; my $Name; $Name = "Audrey"; my @FavoriteHolidays; @FavoriteHolidays = ("Halloween", "Christmas", "Arbor Day"); my %HolidayMonth; $HolidayMonth{“Halloween”} = “October”; $HolidayMonth{“Christmas”} = “December”; $HolidayMonth{“Arbor Day”} = “April”; open (SF, “>SaveFile.txt”); for (my $i=0; $i<3; $i++) { print SF “Number $i favorite holiday for $Name is $FavoriteHolidays[$i]\n”; } Exercise 4: print results to a file #Notice how I had to create SF outside the loop so that the file is globally accessible.

Slide30: 

Regular expressions: comparing sequences These are some of the most useful functions in PERL. They allow you to easily scan your sequence, search for substrings, transpose, etc. =~ is the operator for doing regular expressions. =~ m is the match operator … used to search for a match to some sequence $sequence = “CCATATAGAGATGAGCCTATA”; if ($sequence =~ m/GATGAG/) { print “sequence contains GATGAG\n”; } # This will search $sequence for whatever is between / .. / (GATGAG in this case) .. if any part of your sequence matches GATGAG, the statement is TRUE & you get inside the loop

Slide31: 

Reading in a file: combining file handling and the while statement open (FILE, “FileName.txt”) while (my $line = <FILE>) { chomp($line); print “$line\n”; }

Slide32: 

Reading in a file: combining file handling and the while statement open (FILE, “FileName.txt”) while (my $line = <FILE>) { chomp($line); print “$line\n”; } create a variable to hold each line of the file <..> is the line input operator … reads each line in a file while there are more lines in FILE The chomp function removes the last character of the line (you only want to use this if you need to get rid of the ‘return’ character at the end of a line … try with and without this line of code to see what it’s doing.

Slide33: 

Exercise 4: open and read a Fasta file Create a new file called ReadFasta.pl emacs ReadFile.pl Type the usual stuff at the top of the file #!/usr/bin/perl use strict; Open the file upstream.fasta and read in the data using the ‘while’ statement open (FILE, “PAC-genes.fasta”); while (my $line = <FILE>) { # try also with chomp($line); print “line = $line\n”; } Save the file: Ctrl x s Run the file: perl ReadFasta.pl

Slide34: 

#!/usr/bin/perl use strict; open (FILE< “PAC-genes.fasta”); while (my $line = <FILE>) { chomp($line); # try with and without this line print “line is $line\n”; }

Slide35: 

Exercise 4: open and read a Fasta file You will store the fasta sequence data in a Hash. Go back into your program and create a hash to hold the FASTA sequence. Then create a scalar $gene to hold gene name my %Fasta; my $gene; In the while statement, evaluate each line to see if it is Name or Sequence. A fasta file has >NAME\n followed by sequence if ($line =~ m/>/) { # if the line contains a ‘>’ character my $gene = $line; } 8. Now you know that the subsequent lines must be sequence. Store that in the hash else { $Fasta{$gene} = $Fasta{$gene} . $line; } Note what we are doing: we expect >NAME to come before sequence … but the sequence could extend for multiple lines in the file. Therefore, we need to concatenate sequence from multiple lines, hence the “.” operator to concatenate strings … Here we are resetting $Fasta{$gene} to be whatever was stored in there before plus (using the string operator . ) the new line of sequence.

Slide36: 

#!/usr/bin/perl use strict; open (FILE< “upstreams.fasta”); my %Fasta; my $gene; while (my $line = <FILE>) { chomp ($line); if ($line =~m />/) { $gene = $line; } else { $Fasta{$gene} = $Fasta{$gene} . $line; } }

Slide37: 

Exercise 4: open and read a Fasta file Next, you’ll search through each upstream sequence for each gene for a consensus sequence. We need a way to search through all of the sequences, indexed by genes. We will use the “foreach” method of looping. Because the elements of a hash are not stored in any special order, we will use a way to step through each ‘key’ in the hash. foreach my $g (keys %Fasta) { print “gene is $g and sequence is $Fasta{$g}\n”; } This means, foreach of the keys in %Fasta, set $g equal to the key at hand … then do whatever functions on that particular key … for the next loop, $g will get set to the next key in the hash … you will cycle through the data until you’ve gone through all the keys in the hash.

Slide38: 

#!/usr/bin/perl use strict; open (FILE< “upstreams.fasta”); my %Fasta; my $gene; while (my $line = <FILE>) { if ($line =~m />/) { $gene = $line; } else { $Fasta{$gene} = $Fasta{$gene} . $line; } } # be sure to finish loading your file (close the loop) before starting next loop! foreach my $g(keys %Fasta) { print “gene is $g and sequence is $Fasta{$g}\n”; }

Slide39: 

Exercise 4: open and read a Fasta file Next, you’ll search through each upstream sequence for each gene for a consensus sequence. You will make a new hash to store the sequence matches. 10. Next, within your loop … search each upstream sequence for the motif, GATGAG If there is a match, print the data to the screen { if ($Fasta{$g} =~ m/GATGAG/i) { print “$g contains match to GATGAG”; } this little i means do a case-insensitive search

Slide40: 

#!/usr/bin/perl use strict; open (FILE< “upstreams.fasta”); my %Fasta; my $gene; while (my $line = <FILE>) { if ($line =~ m/>/) { $gene = $line; } else { $Fasta{$gene} = $Fasta{$gene} . $line; } } # be sure to finish loading your file (close the loop) before starting next loop! foreach my $g(keys %Fasta) { if ($Fasta{$g} =~ m/GATGAG/i) { print “$g contains GATGAG\n”; } }

Slide41: 

Exercise 4: open and read a Fasta file Finally, save the results to a new file. Create savefile, ‘Matches.txt’ using the open operator … you must create this outside the loop so that it is globally visable to perl: open (SF, “>Matches.txt”); Step through the hash and print the gene and match information to the file Save the file Ctrl x Ctrl s Run the program from the command line perl ReadFasta.pl

Slide42: 

#!/usr/bin/perl use strict; open (FILE< “upstreams.fasta”); my %Fasta; my $gene; while (my $line = <FILE>) { chomp($line); if ($line =~ m/>/) { $gene = $line; } else { $Fasta{$gene} = $Fasta{$gene} . $line; } } open (SAVEFILE, “>Matches.txt”); foreach my $g(keys %Fasta) { if ($Fasta{$g} =~ m/GATGAG/i) { print “$g contains GATGAG\n”; print SAVEFILE “$g contains GATGAG\n”; } }

Slide43: 

One more useful thing … more flexible matching You can also search for less specific motifs by having flexible characters at specific positions in your binding site if ($Fasta{$g} =~ m/GA[GATC]GAG/) { … } Here (specifically, inside the / … / of a ‘match’ expression), the square brackets specify that the match could contain any ONE of the characters listed at that position of the motif. so, GAGGAG, GAAGAG, GATGAG, GACGAG would all match the sequence you’re searching for. if ($Fasta{$g} =~ m/GA[GAT]GAG/) { … } here, GAGGAG, GAAGAG, GATGAG would match but not GACGAG (since C is not specified in the 3rd position).