Dynamic Competitive Interaction: Implications for Strategy and Competitive Intelligence: Dynamic Competitive Interaction: Implications for Strategy and Competitive Intelligence


Slide2: Lynagh’s Two Keys Tavern Two Keys Tavern Consequences of Cutthroat Rivalry


Prisoner’s Dilemma: Prisoner’s Dilemma Criminal 1 Criminal 2 Squeal Squeal Clam Up Clam Up Both Serve 1 Year Both Serve 5 Years #2 Serves 10 Years #1 Goes Free #1 Serves 10 Years #2 Goes Free


What Price a Dollar?: What Price a Dollar? $1.00 will be auctioned off Opening bid is 10¢ Bids increase in 10¢ increments Highest bidder wins $1.00 Top two bidders must pay auctioneer


Three Stooges: Three Stooges Larry, Curley and Moe are in a 3-way duel and agree to take turns shooting each other in that order Accuracy statistics: Larry hits intended target 20% of the time Curley hits intended target 80% of the time Moe hits intended target 100% of the time What should Larry do?


The Playbook: What will they run next?: The Playbook: What will they run next?


Complex Rivalry: Where to move?: Complex Rivalry: Where to move?


Slide8: Firm 1 Actions Firm 2 Actions Competitive Interaction Competitive Outcomes Industry Characteristics Organizational Characteristics


Competitive Dynamics: Competitive Dynamics Observe competitive moves Organize competitive moves Action/response pairs Action repertoires (year-end tallies) Competitive attacks/sequences Measurement/Analysis of Characteristics Four key action pattern characteristics that improve: Market share Stock price Profitability


Strategy as Action : Strategy as Action Externally-directed, observable competitive moves carried out to improve relative competitive position: Pricing Marketing Products Service Capacity Signals Other Airlines Telecom Brewing PCs Software Mutual Funds 41 Industries Generic Actions: Studies: Actions symbolically represented as these


Action-Reaction “Pairs” : Action Pair 1 Action Pair 2 Action Pair 3 Action Pair 4 Company 1 Company 2 Action-Reaction “Pairs” time Action Response Profits Growth Mkt. Share


Action-Reaction “Pairs” : Action Pair 1 Action Pair 2 Action Pair 3 Action Pair 4 Company 1 Company 2 Action-Reaction “Pairs” time Type Implementation Requirement Radicality Irreversibility Likelihood Speed (delay) Matching


Prior Studies: Action “Repertoires” : Prior Studies: Action “Repertoires” time Profits Growth Mkt. Share Year-End Tallies Action Repertoire Company 1 Company 2


Prior Studies: Action “Repertoires” : Prior Studies: Action “Repertoires” time Profits Growth Mkt. Share Year-End Tallies Total Actions Complexity Company 1 Company 2


Sequential Competitive Interaction ?: a b c d e f g h 8 7 6 5 4 3 2 1 Sequential Competitive Interaction ? This Sequence: Black: Knight b4 White: Pawn c3 Black: Bishop g4 White: Queen b5 Black: Pawn c5 Named Sequences: Epaulette’s Mate Sicilian Defense


Sequence Applications...: Sequence Applications... LANGUAGE: BOXING: DNA: qcheaTiueissesne. hsiT si a cesneueq. This is a sequence. Jab...Jab…Uppercut CAGTACATAGTACGATACGA MUSIC: COMPUTER PROGRAM: data actions2; subj = _n_; do i = 1 to max; output = matrix; end; run;


Sequences in Competitive Interaction: Sequences in Competitive Interaction Ordered sample of things Temporal orderliness among elements Logically unified sequence Succession of market-based decisions Patterns in stream of behaviors Coordinated series of actions Actions in a sequential strategic thrust


Competitive Attack: Sequence of Actions: Action Sequence 1 Action Sequence 2 Competitive Attack: Sequence of Actions time Profits Growth Mkt. Share Competitive Attack


Slide19: MKT MKT PRICE MKT PRICE SVC PROD Rival Firm (a) (a’) Time Focal Firm Avg. Attack Volume (a + a’) No. of Actions per Attack Avg. Attack Duration (a + a’) No. days firm sustains attack


Slide20: MKT MKT PRICE MKT PROD PRICE Time MKT MKT PRICE SIG PROD PRICE Time Period 1 Time Period 2 MKT Attack Unpredictability Resemblance of two attack sequences


Slide21: Focal Firm’s Stock Price and/or Market Share Gain Focal Firm’s Competitive Attack Attack Volume Attack Duration Attack Complexity Attack Unpredictability MKT MKT PRICE MKT PROD MKT CAP SIG PROD MKT Attack a Attack a’


Group Exercise: Bud vs. Miller: Group Exercise: Bud vs. Miller Total Actions Count of total actions Average Response Time Avg. number of time units between last competitive move and first competitive response Repertoire Complexity Extent to which repertoire is skewed vs. balanced Attack Unpredictability Lack of discernable action combinations or repetition


Slide23: Response: Less Likely Slower Action Characteristics Implementation Req. Irreversibility Radicality Action/Response Pairs Better Profitability for Attacker


Slide24: Market Share Gain Action Repertoire Characteristics More Actions Complexity Faster Avg. Response Speed Competitive Repertoire and Market Share Gain


Competitive Attack and Market Share Gain: Competitive Attack and Market Share Gain Market Share Gain Competitive Attack Characteristics Attack Volume Attack Duration


Competitive Attack and Market Share Gain: Competitive Attack and Market Share Gain Market Share Gain Simple Complex Extent of Attack Complexity


Competitive Attack and Market Share Gain: Competitive Attack and Market Share Gain Market Share Gain Predictable Unpredictable Extent of Attack Unpredictability


Results: Attack Intensity: Results: Attack Intensity Stock Price Sporadic, Infrequent Intense, Sustained Number of Actions within Sustained Attack per Unit Time Results reversed for relationship between focal firm’s attack and rival’s stock price.


Results: Attack Complexity: Results: Attack Complexity Simple Complex Extent to which Focal Firm’s Attacks Consist of Actions of Many Types Stock Price


Post Hoc: Attack Unpredictability: Post Hoc: Attack Unpredictability Rival’s Stock Price Predicable, Inertia Unpredictable, Change Extent of Change in Focal Firm’s Sequence of Actions


Scoring the Fight: Scoring the Fight Total Actions Faster Responses More Complex Repertoire Unpredictable Attacks Miller Bud


Slide32: Competitive Aggressiveness Performance Market Share Gains Profitability Too much of a good thing? Lynagh’s vs. Two Keys


Implications for CI:Predict Future Behavior of Rivals: Implications for CI: Predict Future Behavior of Rivals Rivals’ prior behavior Patterns Tendencies Type & order of moves Proactiveness Reactiveness Drivers of Behavior Management orientation Decision-making Financial constraints Industry characteristics


Implications for CI:Monitor Your Own Behavior: Implications for CI: Monitor Your Own Behavior Objective measures of competitive behavior Safeguard against complacency, predictability, simplicity Keep rivals off balance / disruption Identify factors that facilitate aggressiveness What combinations of moves are effective? …which are ineffective? …smoke signals?


Conclusions and Implications: Conclusions and Implications Managerial Implications Incorporate dynamic analysis of competitive moves into competitive intelligence program Assists managers to make inform choices about the requisite level of competitive behavior Use stock returns as an important decision-making tool and as a messenger