logging in or signing up Summer Program PowerPoint 2003 Alfanso Download Post to : URL : Related Presentations : Share Add to Flag Embed Email Send to Blogs and Networks Add to Channel Uploaded from authorPOINTLite Insert YouTube videos in PowerPont slides with aS Desktop Copy embed code: (To copy code, click on the text box) Embed: URL: Thumbnail: WordPress Embed Customize Embed The presentation is successfully added In Your Favorites. Views: 307 Category: Entertainment License: All Rights Reserved Like it (0) Dislike it (0) Added: November 19, 2007 This Presentation is Public Favorites: 0 Presentation Description No description available. Comments Posting comment... Premium member Presentation Transcript Immaculata University: Immaculata University Summer Program 2003 ROBIOTECH Team A Members: Team A Members Seinya Musa Coral Wille Leanna RochTeam B Members: Team B Members Andrea Padamonsky Jessica Wismer Annie ManciniTeam C Members: Team C Members Krista Edinger Kelly Brower Amanda Zirzow Agenda: Agenda Project Introduction Project Description Project Approach How Does This Company Want to Use its Skill: How Does This Company Want to Use its Skill First we Brainstormed: Genetic Councilor Recombinant DNA Altering Food Comparison of Human and Animal DNA Identifying Unknown DNA Sequences Helping the Police Find Criminals Using genetics to see who has a disease and may have passed it to anotherSlide8: Our company’s purpose is to accelerate the process of determining what DNA sequences code for. KAJACLASKS is designed for consumers who are in demand for quick medical DNA information. Project Description: Project Description DNA Sequencing Laboratory Company. We specialize in Rabies identification. Project Approach: Project Approach KAJACLASKS was founded in June of 2003 by the summer scientists at Immaculata Company. ~ Scenario ~: ~ Scenario ~ A young boy was in a park. A boy was bitten by a dog. The boy doesn’t remember what he was bitten by. He only remembers there were seven dogs. The parent of the boy was not sure if these dogs had rabies or another type of disease. The parents sent the boy to the hospital to test the boy for rabies. That info was sent to our lab. The parents called the police and eachdog was taken to the vet. The vet took a sample of the dogs’ saliva. The vet then sent the DNA to our bioinformatics lab.KAJACLASKS Divisions: KAJACLASKS Divisions Team A determines whether there is dog DNA in the boy’s wound. Team B determines which dog’s DNA matches with the DNA found in the boy’s wound. Team C determines whether the dog that bit the boy is infected by the rabies virus.Why?: Why? Due to rabies there have been many numbers of human and animals lives lost. Although that number has declined, (on average one or two per year), the costs for research and treatment is hundreds of millions of dollars annually. Why?: Why? In efforts to control rabies, public health professionals will have to apply imaginative, safe, and cost-effective solutions in addition to using traditional measures. By using our new technology we can cheaply diagnose a disease and report back to hospitals. Process(Team A): Our group first researched human and dog KRT9 genes. We then took five swab samples of the wound that contained human and dog KRT9 genes. After our group found that our first two samples were dog sequences, we then sent the dog sequence to be compared to the five possible dog sequences. Once it was matched, the dog was then tested for rabies. Human KRT9 Gene: CTACCTGCAGCCGCCAGTTCACCTCCTCCAGCTCCATGAAGGGCTCCTGCGGCATCGGGG Dog KRT9 Gene: CATCATCAACTGGGGGTATAAGTAGGAAGCCTTGGGGACAGCTCTGTACCCTGCACTCGG Process (Team A)Tools(Team A): Tools (Team A) We used Ndjinn to find normal human KRT9 sequences. BLAST helped us find the dog sequences. The 5 samples were made with copies of the normal sequences. Clustal W compared the 5 sequences. Boxshade puts the Clustal W in colors like the one on the left. We used DrawTree to make an uprooted tree graph. We looked up information on PubMed on NCBI about KRT9. Slide17: Keratin is a protein found on chromosome 17. KRT9 is a molecule that contributes to the structural integrity of a cytoskeleton structure. Keratin is a major component of hair, nails, and skin. It has a rope-like structure that is based on the alpha helix, cross-linked into bundles. Some diseases caused from the mutation of KRT9 are: -Hodgkin disease and renal -breast cancer -colonicadera carcinomas KRT9 (Keratin) (Team A)Animal Criminology Lab (Team B): Animal Criminology Lab (Team B) Our purpose is to take DNA samples from various sources and discover which source matches the original. To do this, we must put to use many of the bioinformatics tools from Biology Workbench, including: BLAST, CLUSTAL, boxshade, and Ndjinn.Procedure(Team B): Procedure (Team B) First, we took seven different sequences from seven different dogs and we compared them with the Keratin 9 sequence from the dog, which was found in the human wound. Then, we used CLUSTALW to see which sequence matched the original. Presentation of Data(Team B): Presentation of Data (Team B) This is an example of the CLUSTALW output after being aligned with box shade. Slide21: The Matching Sequence (Team B) After extensive analysis, we determined that, of the seven sequences, dog 3 was the culprit.What is the Rabies Virus?(Team C): The rabies virus genome is single-stranded, antisense, nonsegmented, RNA of approximately 12 kb. There is a leader-sequence (LDR) of approximately 50 nucleotides, followed by N, P, M, G, and L genes. There are only five genes in the organism compared to the 30,000 some genes in human DNA. What is the Rabies Virus? (Team C)Rabies Box Shade Comparison(Team C): Rabies Box Shade Comparison (Team C) The top strand is the Rabies DNA and the bottom strand is the Dog’s DNA. The yellow part allows you to see the differences in the two sequences. Rabies Box Shade(Team C): Rabies Box Shade (Team C) The green areas show where the two sequences are identical As you can see, the sequences align properly which indicates that dog 3 does in fact have rabies.Conclusion: Conclusion From the information gathered it was determined that the young boy contracted the rabies virus via the infected dog. The boy must now go through a series of vaccinations in order to fight the virus.References : References NCBI (National Center for Biotechnology Information) WebMD Biology Workbench Biology WorkbenchImmaculata UniversitySummer Program 2003: Immaculata University Summer Program 2003Slide28: All of the young ladies that participated in the Bioinformatics program would like to give a special thank you to Sister Susan Cronin IHM, PhD. Thank you for teaching us all of the tools to use in researching DNA sequences, we truly appreciate it and we love you. You do not have the permission to view this presentation. In order to view it, please contact the author of the presentation.
Summer Program PowerPoint 2003 Alfanso Download Post to : URL : Related Presentations : Share Add to Flag Embed Email Send to Blogs and Networks Add to Channel Uploaded from authorPOINTLite Insert YouTube videos in PowerPont slides with aS Desktop Copy embed code: (To copy code, click on the text box) Embed: URL: Thumbnail: WordPress Embed Customize Embed The presentation is successfully added In Your Favorites. Views: 307 Category: Entertainment License: All Rights Reserved Like it (0) Dislike it (0) Added: November 19, 2007 This Presentation is Public Favorites: 0 Presentation Description No description available. Comments Posting comment... Premium member Presentation Transcript Immaculata University: Immaculata University Summer Program 2003 ROBIOTECH Team A Members: Team A Members Seinya Musa Coral Wille Leanna RochTeam B Members: Team B Members Andrea Padamonsky Jessica Wismer Annie ManciniTeam C Members: Team C Members Krista Edinger Kelly Brower Amanda Zirzow Agenda: Agenda Project Introduction Project Description Project Approach How Does This Company Want to Use its Skill: How Does This Company Want to Use its Skill First we Brainstormed: Genetic Councilor Recombinant DNA Altering Food Comparison of Human and Animal DNA Identifying Unknown DNA Sequences Helping the Police Find Criminals Using genetics to see who has a disease and may have passed it to anotherSlide8: Our company’s purpose is to accelerate the process of determining what DNA sequences code for. KAJACLASKS is designed for consumers who are in demand for quick medical DNA information. Project Description: Project Description DNA Sequencing Laboratory Company. We specialize in Rabies identification. Project Approach: Project Approach KAJACLASKS was founded in June of 2003 by the summer scientists at Immaculata Company. ~ Scenario ~: ~ Scenario ~ A young boy was in a park. A boy was bitten by a dog. The boy doesn’t remember what he was bitten by. He only remembers there were seven dogs. The parent of the boy was not sure if these dogs had rabies or another type of disease. The parents sent the boy to the hospital to test the boy for rabies. That info was sent to our lab. The parents called the police and eachdog was taken to the vet. The vet took a sample of the dogs’ saliva. The vet then sent the DNA to our bioinformatics lab.KAJACLASKS Divisions: KAJACLASKS Divisions Team A determines whether there is dog DNA in the boy’s wound. Team B determines which dog’s DNA matches with the DNA found in the boy’s wound. Team C determines whether the dog that bit the boy is infected by the rabies virus.Why?: Why? Due to rabies there have been many numbers of human and animals lives lost. Although that number has declined, (on average one or two per year), the costs for research and treatment is hundreds of millions of dollars annually. Why?: Why? In efforts to control rabies, public health professionals will have to apply imaginative, safe, and cost-effective solutions in addition to using traditional measures. By using our new technology we can cheaply diagnose a disease and report back to hospitals. Process(Team A): Our group first researched human and dog KRT9 genes. We then took five swab samples of the wound that contained human and dog KRT9 genes. After our group found that our first two samples were dog sequences, we then sent the dog sequence to be compared to the five possible dog sequences. Once it was matched, the dog was then tested for rabies. Human KRT9 Gene: CTACCTGCAGCCGCCAGTTCACCTCCTCCAGCTCCATGAAGGGCTCCTGCGGCATCGGGG Dog KRT9 Gene: CATCATCAACTGGGGGTATAAGTAGGAAGCCTTGGGGACAGCTCTGTACCCTGCACTCGG Process (Team A)Tools(Team A): Tools (Team A) We used Ndjinn to find normal human KRT9 sequences. BLAST helped us find the dog sequences. The 5 samples were made with copies of the normal sequences. Clustal W compared the 5 sequences. Boxshade puts the Clustal W in colors like the one on the left. We used DrawTree to make an uprooted tree graph. We looked up information on PubMed on NCBI about KRT9. Slide17: Keratin is a protein found on chromosome 17. KRT9 is a molecule that contributes to the structural integrity of a cytoskeleton structure. Keratin is a major component of hair, nails, and skin. It has a rope-like structure that is based on the alpha helix, cross-linked into bundles. Some diseases caused from the mutation of KRT9 are: -Hodgkin disease and renal -breast cancer -colonicadera carcinomas KRT9 (Keratin) (Team A)Animal Criminology Lab (Team B): Animal Criminology Lab (Team B) Our purpose is to take DNA samples from various sources and discover which source matches the original. To do this, we must put to use many of the bioinformatics tools from Biology Workbench, including: BLAST, CLUSTAL, boxshade, and Ndjinn.Procedure(Team B): Procedure (Team B) First, we took seven different sequences from seven different dogs and we compared them with the Keratin 9 sequence from the dog, which was found in the human wound. Then, we used CLUSTALW to see which sequence matched the original. Presentation of Data(Team B): Presentation of Data (Team B) This is an example of the CLUSTALW output after being aligned with box shade. Slide21: The Matching Sequence (Team B) After extensive analysis, we determined that, of the seven sequences, dog 3 was the culprit.What is the Rabies Virus?(Team C): The rabies virus genome is single-stranded, antisense, nonsegmented, RNA of approximately 12 kb. There is a leader-sequence (LDR) of approximately 50 nucleotides, followed by N, P, M, G, and L genes. There are only five genes in the organism compared to the 30,000 some genes in human DNA. What is the Rabies Virus? (Team C)Rabies Box Shade Comparison(Team C): Rabies Box Shade Comparison (Team C) The top strand is the Rabies DNA and the bottom strand is the Dog’s DNA. The yellow part allows you to see the differences in the two sequences. Rabies Box Shade(Team C): Rabies Box Shade (Team C) The green areas show where the two sequences are identical As you can see, the sequences align properly which indicates that dog 3 does in fact have rabies.Conclusion: Conclusion From the information gathered it was determined that the young boy contracted the rabies virus via the infected dog. The boy must now go through a series of vaccinations in order to fight the virus.References : References NCBI (National Center for Biotechnology Information) WebMD Biology Workbench Biology WorkbenchImmaculata UniversitySummer Program 2003: Immaculata University Summer Program 2003Slide28: All of the young ladies that participated in the Bioinformatics program would like to give a special thank you to Sister Susan Cronin IHM, PhD. Thank you for teaching us all of the tools to use in researching DNA sequences, we truly appreciate it and we love you.