Rossi RNAilecturedallas

Views:
 
     
 

Presentation Description

Presented by Dr. John Rossi at the Alliance for Contraception in Cats & Dogs’ 4th International Symposium on Non-Surgical Contraceptive Methods of Pet Population Control, April 8-10, 2010, in Dallas, Texas, U.S.

Comments

Presentation Transcript

Slide 1: 

Functions and Therapeutic Applications of siRNAs John Rossi, Dept. of Molecular and Cellular Biology-Irell and Manella Graduate School of Biological Sciences-Beckman Research Institute at the City of Hope, Duarte, CA jrossi@coh.org

Slide 2: 

Kim and Rossi Nature Reviews Genetics 8, 173–184 (March 2007) | doi:10.1038/nrg2006

MicroRNAs : 

MicroRNAs Current estimates are 800-1,000 miRNAs in humans based upon cloning of miRNAs and bioinformatics. Many are phylogenetically conserved from worms to man. miRNAs regulate translation but also promote message degradation. Identifying miRNA targets is at present the major challenge. miRNA profiling reveals a strong correlelation between specific miRNAs and specific types of cancer. miRNAs are believed to be critical in early cellular differentiation and in maintaining differentiated state.

MicroRNA formation : 

MicroRNA formation miRNA’s are processed from several precursor stages Mammalian genomes seem to have 100’s of miRNA’s

Slide 5: 

3’ UACGCGAGCCGACCCUACCUCC Nucleotides in positions 2-8 of an miRNA are considered the miRNA seed 3’ UGAUAUGUUGGAUGAUGGAGU 5’ miRNA Let-7a polyA tail 3’ 5’ Methyl-G cap mRNA target Antagomir=backbone modified antisense complementary to miRNA-binds and blocks function. Functional inhibition of miRNA loaded RISC. X

Slide 7: 

Nat. Cell Biol. 2005 RNAi takes place in cytoplasmic organelles called P bodies

siRNA : 

siRNA 5’ 3’ 3’ 5’ Small interfering RNAs or siRNAs bind to their targets by full complementarity and direct RISC to cleave target mRNA at a precise position.

Slide 10: 

Parker et al., Nature 2005 Binding of siRNA in Piwi domain of Argonautes A. fulgidus Piwi protein

Cleavage Takes Place at Center of siRNA-Target Duplex : 

Cleavage Takes Place at Center of siRNA-Target Duplex UUCGGACACGGAGAAGUCGAUGp5′ NAAGCCUGUGCCUCUUCAGCUACC 5′ AAAn RNA A helix required for Ago2 mediated cleavage Hutvagner G, Zamore PD. Science. 2002;297:2056-60. Cleavage of target directed by middle of siRNA measured 10 nucleotides from 5′ end of siRNA 11,10

Slide 12: 

Figure 4 Elbashir, SM et al 2001 Nature 411:494 First demonstration of RNAi in Mammalian Cells

Triggering RNAi in Mammalian Cells : 

Triggering RNAi in Mammalian Cells Scherer LJ, Rossi JJ. Nat Biotechnol. 2003;21:1457-65. shRNA = short hairpin RNA; siRNA = short interfering RNA; RISC = RNA-induced silencing complex

Slide 14: 

Kim and Rossi Nature Reviews Genetics 8, 173–184 (March 2007) | doi:10.1038/nrg2006

Slide 15: 

Kim and Rossi Nature Reviews Genetics 8, 173–184 (March 2007) | doi:10.1038/nrg2006 Vector based delivery of shRNAs and miRNA mimics

Slide 17: 

Kim and Rossi Nature Reviews Genetics 8, 173–184 (March 2007) | doi:10.1038/nrg2006

Slide 18: 

Kim and Rossi Nature Reviews Genetics 8, 173–184 (March 2007) | doi:10.1038/nrg2006 Some clinical trials for RNAi

Systemic delivery of siRNAs : 

Systemic delivery of siRNAs Getting RNAs to target cells. Example of Ewings’ Sarcoma target transcript. mRNA derives from fusion of two genes to create novel target Hu-Lieskovan, S, et al., Cancer Research, 65:2005

EWS-FLI1 gene fusion in Ewing’s Sarcoma : 

EWS-FLI1 gene fusion in Ewing’s Sarcoma

Cyclodextrin : 

Cyclodextrin LD50 i.v. rat b-CD ~0.5 g/kg Methylated b -CD: no toxicity at 1 g/kg each week for 4 doses i.v.hydroxypropyl- b -CD in monkeys of 10 g/kg is not lethal

Experimental Design : 

Experimental Design NOD/SCID 6-8wk Lentivirus Luciferase Construct 5x106 Cells per mouse Formulated siRNA TfR-positive TC71

GROUPS : 

GROUPS D5W --- solution Naked EFBP2 siRNA in D5W Fully formulated siCON1 in D5W Targeted EFBP2 siRNA in D5W -- transferrin ligand Non-targeted EFBP2 siRNA in D5W -- no transferrin

Slide 29: 

MOUSE IMAGES FOR ALL TREATMENT GROUPS

mg/kg Twice Weekly Injections for Four Weeks – 2.5 : 

mg/kg Twice Weekly Injections for Four Weeks – 2.5

Summary : 

Summary Fully formulated CD with transferrin ligand and anti-EWS-Fli1 siRNA effectively block tumor formation in vivo in a murine system. Potential Carrier for other siRNAs and other applications. Calando Pharmceuticals, Inc., Pasadena, CA

Cell Internalizing Aptamers for siRNA Delivery : 

Cell Internalizing Aptamers for siRNA Delivery Aptamers are single stranded RNAs that have been evolved by in vitro selection to bind a specific protein or other ligand with low nanomolar to picomolar Kd. Giangrande et al (Nat. Bio Tech. 2006) and Zhou et al (Nuc. Acids Res. 2009) demonstrated aptamer mediated, cell type specific delivery of therapeutic siRNAs to PSMA expressing prostate cancer cells or to HIV infected cells respectively.

Slide 33: 

In vitro Screening of RNA Aptamers by SELEX

Slide 34: 

Anti HIV gp120 Envelope aptamers

Slide 35: 

Cell type-specific delivery system: Aptamer-stick-siRNA system

Slide 36: 

Delivery application of anti-gp120 aptamer

Slide 37: 

Humanized RAG-hu mouse test of anti-gp120 aptamer-siRNA chimeras Chimeras A-1 Naked siRNA Untreated 3 weeks infection 1th week infection 5th week 6th week 7th week 8th week 4th week injection The humanized Rag2-/-gc-/- mice (RAG-hu) engrafted with CD34 hematopoietic progenitor cells were infected with HIV-1 NL4.3 virus intraperitonially. One injection of 10 g experimental RNA per week. 5th week sample for siRNA and Tat/rev detection 1-9 weeks samples for viral loading test monitored by real-time PCR. injection Rag2-/-gamma c-/- mouse

Slide 38: 

Comparisons of aptamer vs aptamer-chimera and mutant aptamer chimera in vivo Treatment start-stop

Slide 39: 

: HIV tat/rev target knockdown mediated by aptamer delivered siRNA

Aptamer-siRNA delivery for animal sterilization : 

Aptamer-siRNA delivery for animal sterilization Identify specific receptor on target cells/tissue of interest Select aptamer using purified receptor or cell based selection. Use aptamer to deliver siRNA(cocktail) to trigger apoptosis of target cells/tissues.

authorStream Live Help